Pharmacological Inhibition of N-Acylethanolamine Acid Amidase (NAAA) Mitigates Intestinal Fibrosis Through Modulation of Macrophage Activity
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Molecular Medicine and Medical Biotechnology, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Clinical Medicine and Surgery, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Molecular Medicine and Medical Biotechnology, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Clinical Medicine and Surgery, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Agricultural Sciences, University of Naples Federico II, Portici, Italy
Center for Drug Discovery and Department of Pharmaceutical Sciences, Northeastern University, Boston, MA, USA
Institute of Biomolecular Chemistry, National Research Council, Pozzuoli, Italy
Epitech Group SpA, Saccolongo, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy
Abstract
Background and Aims
Intestinal fibrosis, a frequent complication of inflammatory bowel disease, is characterized by stricture formation with no pharmacological treatment to date. N-acylethanolamine acid amidase (NAAA) is responsible for the hydrolysis of acylethanolamides (AEs, eg, palmitoylethanolamide and oleoylethanolamide). Here, we investigated NAAA and AE signaling in gut fibrosis.
Methods
NAAA and AE signaling were evaluated in human intestinal specimens from patients with stenotic Crohn’s disease (CD). Gut fibrosis was induced by 2,4,6-trinitrobenzenesulfonic acid, monitored by colonoscopy, and assessed by qRT-PCR, histological analyses, and confocal microscopy. Immune cells in mesenteric lymph nodes were analyzed by FACS. Colonic fibroblasts were cultured in conditioned media derived from polarized or non-polarized bone marrow-derived macrophages (BMDMs). IL-23 signaling was evaluated by qRT-PCR, ELISA, FACS, and western blot in BMDMs and in lamina propria CX3CR1+ cells.
Results
In ileocolonic human CD strictures, increased transcript expression of NAAA was observed with a decrease in its substrates oleoylethanolamide and palmitoylethanolamide. NAAA inhibition reduced intestinal fibrosis in vivo, as indicated by a decrease in inflammatory parameters, collagen deposition, and fibrosis-related genes, including those involved in epithelial-to-mesenchymal transition. More in-depth studies revealed modulation of the immune response related to IL-23 following NAAA inhibition. The antifibrotic actions of NAAA inhibition are mediated by Mφ and M2 macrophages that indirectly affect fibroblast collagenogenesis. NAAA inhibitor AM9053 normalized IL-23 signaling in BMDMs and in lamina propria CX3CR1+ cells.
Conclusions
Our findings provide new insights into the pathophysiological mechanism of intestinal fibrosis and identify NAAA as a promising target for the development of therapeutic treatments to alleviate CD-related fibrosis.
Untitled section
Keywords: Acylethanolamides, intestinal fibrosis, IL-23
Graphical Abstract
Article notes
Untitled section
Received 2023 Dec 21; Revised 2024 Aug 10; Accepted 2024 Aug 27; Collection date 2025 Feb.
1. Introduction
Intestinal fibrosis is a frequent long-term complication of inflammatory bowel diseases (IBD), most prevalent in Crohn’s disease (CD), and is characterized by excessive deposition of extracellular matrix (ECM), which, in turn, leads to organ damage, bowel obstruction, and strictures.1 The development of intestinal fibrosis is a multistep and heterogeneous process influenced by several factors (eg, genetic susceptibility, dysregulation in immune signature, environmental triggers) that sustain fibrotic mechanisms.2–4 Many soluble factors have proved to play a key role in persistent inflammation and gut fibrosis, including different cellular components (ie, myofibroblasts/fibroblasts and macrophages) and cytokines.5,6 Among cytokines, interleukin (IL)-23 plays a leading role in gut immunity and tissue repair.7,8 IL-23 acts as a pleiotropic cytokine secreted by macrophages and dendritic cells that induces secretion of IL-17 and IL-22 from T cells.9 IL-23 levels are elevated in the intestine of CD patients,10 and neutralization of IL-23 ameliorates intestinal inflammation by reducing IL-17 accumulation.11 Also, pharmacological inhibition of mTOR attenuates the induction of IL-23 and concurrent intestinal fibrosis.12 Importantly, IL-23 is druggable: IL-23 blockade is an effective and safe therapeutic option for both CD and ulcerative colitis with several clinical trials completed or underway.13 Despite the improvement in the understanding and management of IBD, almost no progress has been made in the development of antifibrotic therapies. Surgical resection and endoscopic dilation are the only treatments available for symptomatic fibrotic strictures with both strategies associated with a high rate of recurrences.14 Therefore, unraveling the mechanisms underlying fibrosis and discovering new treatment approaches are of utmost importance and considered a high priority.
Previous studies have shown that fibrosis is associated with abnormal lipid metabolism. Although the causes and consequences of such metabolic alterations remain poorly understood, it is now well established that pharmacologic targeting of lipid metabolic processes has great potential for the inhibition of fibrosis development.15 Acylethanolamides (AEs) are a family of endogenous lipid molecules that include anandamide (AEA), palmitoylethanolamide (PEA), and oleoylethanolamide (OEA), which are known to mediate several pathophysiological functions, including inflammation.16 AEA and PEA are involved in fibrosis mechanisms in multiple organ systems,17–25 whereas OEA attenuates liver fibrosis.26,27 AE actions are terminated by two metabolic enzymes: fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amidase (NAAA) which, in turn, regulate AE endogenous levels.16 FAAH’s role in organ fibrosis has been quite extensively studied, although its role is still controversial.28,29 NAAA is an N-terminal cysteine hydrolase primarily found in the endosomal-lysosomal compartment of innate and adaptive immune cells30 and is also expressed in several organs, including prostate, lung, spleen, and intestine.31 NAAA inhibition results in increased AE endogenous levels that, in turn, exert beneficial effects on several inflammatory-based disorders, including those affecting the gut.32 However, our knowledge of the function of NAAA in fibrosis in general, and consequently in the gut, is completely unknown.
Our study was aimed at elucidating for the first time the role and the mechanism of action of NAAA in gut fibrosis. We first evaluated NAAA expression and AE levels in human CD fibrotic tissues. We assessed the role of NAAA in an experimental murine model of intestinal fibrosis, in colonic fibroblasts cultured in the presence of macrophage-conditioned media, in CX3CR1+ mononuclear phagocytes, and in bone marrow-derived macrophages (BMDMs).
2. Methods
2.1. Drugs
AM9053 was used to induce a reversible NAAA inhibition. This compound was designed and synthesized in the laboratory of Professor Alex Makriyannis as previously described.33 All the reagents for in vitro cell cultures were provided by Merck (Milan, Italy), Sial Group (Rome, Italy), and/or Bio-Rad (Segrate, Italy). The vehicles used for in vivo experiments (10% ethanol, 10% Tween-20, 80% saline, 2 mL/kg) and in vitro experiments (0.1% ethanol) had no effect on the responses under study.
2.2. Animals
Mice used for the project were housed at the conventional animal house of the Centro di Biotecnologie A.O.R.N. Antonio Cardarelli (Naples, Italy) and kept in cages supplemented with environmental enrichment, with free access to water, in accordance with the guidelines for reporting experiments involving animals. Female C57BL/6J mice were used to induce intestinal fibrosis, and male C57BL/6J mice were used for the collection and isolation of BMDMs. All the animals, weighing 20-25 g, were purchased from Charles River (Sant’Angelo Lodigiano, Italy) and housed in polycarbonate cages under a 12-hour light/12-hour dark cycle, with a temperature of 23 ± 2 °C and 60% humidity. Animals were fed ad libitum with standard food, except for the 24-hour period immediately preceding the administration of 2,4,6-trinitrobenzenesulfonic acid (TNBS), and they were anesthetized with enflurane inhalation before being humanely euthanized with carbon dioxide. All efforts were made to minimize the number of animals used and their suffering. Mice were blindly randomized, and experimental procedures and protocols were in conformity with national (Direttiva 2010/63/UE) laws and policies and approved by the Italian Ministry of Health (approval number 54/2023-PR).
2.3. In vivo model of intestinal fibrosis
Intestinal fibrosis was induced as previously described34 by the administration of a hydroalcoholic solution (ethanol 50% vol/vol) of TNBS that compromises the barrier function of the intestinal wall, allowing TNBS access. Accordingly, a presensitization phase was performed with topical administration of 1% (vol/vol) TNBS. Thereafter, the protocol involved the intrarectal administration (under inhalation anesthesia) of TNBS once a week according to an increasing dosing scheme (0.75%, 1.5%, 2.5% vol/vol) for the following 6 weeks using a specific polyethylene catheter (1 mm in diameter). AM9053 (20 mg/kg, intraperitoneally [i.p.]), a selective and potent NAAA inhibitor, was administered i.p. 3 times a week until the day of the sacrifice.35 Animal weights were monitored weekly, and the Disease Activity Index (DAI) score was assessed every 2 days by evaluating stool consistency and the visible presence of blood. At the end of the experiment, on the 49th day, all mice were euthanized by asphyxiation with CO2, and the colons were removed, rinsed, weighed, and measured for length. Thereafter, colon tissues were stored at −80 °C for further analyses.
2.4. Endoscopic analysis
Endoscopic analysis was performed at time zero and on the final day (49th day) using high-resolution mini-endoscopy to assess the degree of intestinal inflammation and fibrosis. All mice were anesthetized by subcutaneous injection of alfaxalone (5 mg/kg) and xylazine (5 mg/kg) and examined using a mini-endoscope (Mainz COLOVIEW System, Karl Storz, Germany). Scoring of fibrosis activity was expressed using the modified Murine Endoscopic Index of Colitis Severity (MEICS) based on the following 4 parameters: (i) thickening of the colon, (ii) stool consistency, (iii) changes in the vascular pattern, and (iv) fibrin visible.36 Endoscopic grading was performed for each parameter (scores 0-3), leading to a cumulative score between 0 and 15.
2.5. Hematoxylin-eosin staining and Masson’s trichrome staining
Histological analyses were performed using colon segments fixed in formaldehyde, dehydrated in graded ethanol, and embedded in paraffin. Subsequently, colon tissues were sliced into 5-µm thick slides. The sections were dewaxed in xylene for 10 minutes and dehydrated in gradient alcohol. Sections were used for both hematoxylin and eosin (H&E) staining to visualize colon anatomy and Masson’s trichrome staining to quantify collagen deposition. To perform H&E staining, sections were stained with hematoxylin for 8 minutes and eosin for 2 minutes. To perform Masson’s trichrome staining, slides were first incubated in Bouin’s solution at 56 °C for 15 minutes, rinsed with tap water, stained with Weigert’s iron hematoxylin solution for 5 minutes, and washed to remove the excess solution. Slides were then stained in phosphotungstic/phosphomolybdic acid solution for 5 minutes, in aniline blue solution for 5 minutes, and in 1% acetic acid for 2 minutes. Finally, slides were rinsed, dehydrated through alcohol, cleared with xylene, and mounted. All slides stained with H&E and Masson’s trichrome stains were sealed and examined under a light microscope (Leica, Germany). Photographs were acquired using a 10× objective.
2.6. Confocal immunofluorescence analysis
Slides of colon tissue (5 µm) were deparaffinized with xylene and rehydrated through a decreasing gradient of alcohol. Antigen retrieval was carried out through pressure-cooking slides for 3 minutes in the Diva Decloaker solution 10× (Biocare Medical, CA, USA). To avoid nonspecific interactions of antibodies, the slides were treated for 2 hours in 5% bovine serum albumin (BSA) in phosphate buffered saline (PBS). Immunostaining was performed by incubation overnight with anti-alpha smooth muscle actin (α-SMA; 1:100, Alexa Fluor 488, Cat. #AB124964, Abcam) at 4 °C. The slides were mounted on microscope slides using Mounting Medium (Cat. #AB104135, Abcam) and then counterstained with DAPI (Cat. #AB228549, Abcam) for nuclear staining. The images were acquired at room temperature and detected under 40× magnification using a laser-scanning confocal microscope with an AiryScan2 module (Zeiss, LSM 900, Germany). Three fields for each colon were analyzed using Zeiss Zen Blue edition software.
2.7. Cell preparation from mesenteric lymph nodes
Mesenteric lymph nodes (MLNs) were aseptically removed from the experimental mice and disrupted with a syringe pump in RPMI 1640 medium, supplemented with 10% fetal calf serum (FCS), 100 U/mL penicillin, 100 μg/mL streptomycin, 10 mM HEPES, and 11 mM sodium carbonate. Cell suspensions of MLNs were passed through a sterile filter to remove any debris, and red blood cells were lysed using red blood cell lysis buffer (Thermo Fisher Scientific, Milan, Italy). After centrifugation, cell suspensions were washed twice in RPMI 1640 and stored on ice in a medium containing 5% fetal bovine serum (FBS). Successively, cell suspensions were counted and used for flow cytometry analyses.37–39
2.8. Characterization of intestinal lamina propria of CX3CR1+ mononuclear phagocytes
In brief, colons were collected and longitudinally opened, cut into 1-cm pieces, washed in ice-cold Hank’s Balanced Salt Solution (HBSS) (Cat. #21020-CV, Corning), and kept on an ice-cold solution of PBS containing 5% BSA. Colon pieces were incubated in 7 mL of predigestion solution (RPMI containing 5% FBS and 5 mM EDTA) in a 50-mL tube rotated at 100 rpm for 20 minutes at 37 °C in an incubator. The predigestion solution was replaced with 10 mL of RPMI containing 5% FBS and 0.01 M HEPES, and colon tissues were incubated for 10 minutes. Subsequently, colon pieces were incubated with the digestion medium (RPMI containing 5% FBS, DNase I [Cat. #1014159001, Roche], and Collagenase VIII [Cat. #C2139, Sigma]) under agitation for 45 minutes at 37 °C in an incubator. The detached colonic epithelial cells were discarded by passing them through a 100-μm cell strainer in a 50-mL tube, and fresh EDTA was added to the solution. Mononuclear phagocytes were spun down for 5 minutes at 1500 rpm, resuspended in 5 mL of PBS containing 5% of BSA, and counted using TC20 Automated Cell Counter (Bio-Rad).
2.9. Flow cytometry
Lymphocytes isolated from MLNs were washed in FACS buffer (PBS containing 1% BSA and 0.02% NaN2) and stained directly with the following conjugated antibodies: CD3 (1:200, clone 17A2), CD4 (1:200; clone GK1.5; BioLegend), CD8 (1:200; clone 5H10-1; BioLegend), and CD25 (1:200; clone 3C7; BioLegend) for 60 minutes at 4 °C. After washing, cells were fixated, permeabilized, and stained intracellularly with IFN-γ (1:200; clone XMG1.2, Cat. #505807; BioLegend), IL-4 (1:200; clone clone 11B11, Cat. #504103; BioLegend), IL-17A (1:200; clone TC11-18H10.1; BioLegend), and FoxP3 antibody (1:200; clone MF-14; BioLegend). Th1, Th2, Th17, and regulatory T cell (Treg) populations were defined as CD4+INF-γ+, CD4+IL-4+, CD4+IL-17+, and CD4+CD25+FoxP3+ cells, respectively.40 At least 1 × 104 cells were analyzed per sample and gating strategy with related and positive and negative populations are shown in Supplementary Figures 1 and 2. Mononuclear phagocytes from lamina propria were washed in FACS buffer (containing PBS and 5% BSA), and for detecting intracellular cytokines, cell suspensions were incubated for 3 hours with PMA (50 ng/mL) (Cat. #P8139, Sigma) and Ionomycin (1 μg/mL) in the presence of BD Golgi Plug (Cat. #555028, BD Bioscience), followed by incubation on ice for 10 minutes with anti-mouse CD16/CD32 at 1:50 dilution to block Fc receptors (Mathur et al12). Cells were washed and stained directly with the following conjugated antibodies: CD45 (1:400, clone 30-F11, Cat. #25-0451-82, Invitrogen), CD11b (1:200, clone M1/70, Cat. #45-0112-82, Invitrogen), F4/80 (1:50, clone REA126 Cat. #130-116525, Miltenyi), and CX3CR1 (1:500, clone SA011F11, Cat. #1345095, Sony) for 60 minutes at 4 °C. After washing, cells were fixed, permeabilized, and stained intracellularly for IL-23 (10 µL/test, clone 320244, Cat. #MA5-23617, Invitrogen) for 60 minutes at 4 °C. CX3CR1+ macrophage fraction was defined as CD45+CD11b+F480+CX3CR1+, and IL-23 was quantified on both CX3CR1int and CX3CR1high. At least 5 × 104 cells were analyzed per sample, and macrophage fraction was identified according to the gating strategy shown in Supplementary Figure 3A. Unstained cells were used to set positive populations for CX3CR1 and IL-23 (Supplementary Figure 3B). Flow cytometry was performed on BriCyte E6 flow cytometer (Mindray Bio-Medical Electronics, Nanshan, China) using FlowJo software. For characterization of macrophage subsets from colon lamina propria fractions in TNBS-treated mice and TNBS + NAAA inhibitor-treated mice, cells were stained with CD45 (1:400, Cat. #1115675, Clone 30-F11, Sony), CD64 (1:100, Cat. #1296545, Clone Mouse IgG1, Sony), CD11b (1:200, Cat. #45-0112-82, Clone M1/70, Invitrogen), Cd11c (1:200, Cat. #25-0114-82, Clone N418), CX3CR1 (1:500, Cat. #1345095, Clone SA011F11, Sony), Ly6C (1:50, Cat. #1240080, HK1.4), and MHCII (0.5 µL/test, Cat. #56532180, Clone M5/114.15.2, Invitrogen). Macrophage subsets were defined as P2 (MHCIIhigh/CX3CR1int/Ly6Chigh), P3 (MHCIIhigh/C X3CR1int/Ly6Clow), and P4 fraction (MHCIIhigh/C X3CR1hi/Ly6clow). Cells were acquired using the FACs sorter Sony SH800S (Sony Biotechnology, CA, USA).
2.10. BMDM isolation and pharmacological treatments
Mouse femurs and tibias were flushed with macrophage culture medium (RPMI 1640 containing 100 U/mL of penicillin/streptomycin, 1 mM HEPES [pH 7.4], and 10% FBS), and the bone marrows were filtered through 70-µm cell strainers. Cells were thereafter incubated in a macrophage culture medium supplemented with macrophage colony-stimulating factor (M-CSF) (50 ng/mL) (Miltenyi Biotec, Germany) for 6 days. BMDMs were then reseeded and first exposed to the noncytotoxic AM9053 concentration (1 µM) for 1 hour prior to treatment with lipopolysaccharide (LPS) (10 ng/mL) for 3 hours. This pharmacological schedule was chosen to have the most effective IL-23 production.12 Additionally, for coculture experiments, BMDMs were seeded (15 × 104) and, the following day, were first exposed to the noncytotoxic AM9053 concentration (1 µM) for 1 hour, and then characterized in unpolarized phenotype (Mφ) and polarized M1 (100 ng/mL LPS with 50 ng/mL IFN-γ) and M2 (10 ng/mL IL-4) phenotypes up to 18 hours.41 Subsequently, the Mφ-, M1-, and M2-like BMDM supernatants were collected and added to the colon fibroblasts culture, as described above.
2.11. Isolation of primary colonic fibroblasts
Colonic fibroblasts were freshly isolated from mouse colon tissue, as previously described.42 In summary, colon tissues were collected, flashed with ice-cold PBS, and opened longitudinally, and 0.5 cm pieces were incubated in a prewarmed separation solution of HBSS solution containing 10% FBS, 0.5 M EDTA, and 100 mM EGTA (Cat. #67425, Roth) for 45 minutes under agitation at 37 °C in an incubator. Subsequently, colon pieces were digested in Dulbecco’s modified Eagle medium F12 (DMEM/F12, Cat. #11320-074, Gibco) with an enzyme mix containing DNase I (1000 U/mL), collagenase D (0.1 U/mL) (Cat. #11088866001, Roche), and Dispase II (1.5 U/mL) (Cat. #14828300, Roche) until the tissue was fully digested. For collagenogenesis gene expression, we used colonic fibroblasts (passages 4-6) seeded at 3 × 104 cells in a 24-well plate in DMEM/F12 containing 10% FBS, 2.5% HEPES, 1% Glutamine, and 1% penicillin/streptomycin in a humidified 5% CO2 atmosphere. Twenty-four hours later, polarized BMDM medium (as previously described) was added to colonic fibroblasts for 5 days and changed every 2 days. On Day 7, fibroblasts were detached with PUREZOL Reagent and collected for further analysis.
2.12. Intestinal myofibroblasts CCD-18Co cell culture
The human intestinal myofibroblast cell line CCD-18Co was purchased from the American Type Culture Collection (ATCC) and used as an in vitro intestinal myofibroblast cell model.43 CCD-18Co cells were cultured in EMEM (ATCC) containing 10% FBS, 2.5% HEPES, and 100 U/mL penicillin/streptomycin at 37 °C in a humidified 5% CO2 atmosphere in presence of TGF-β (10 ng/mL).
2.13. Cell viability assay
BMDM cell viability was evaluated by performing 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, based on the principle that metabolically active cells can convert the yellow water-soluble MTT reagent into purple formazan crystals.44 Briefly, BMDMs (3 × 104 cells seeded in a 96-well plate), with or without pretreatment with AM9053 (0.03-10 μM) for 1 hour before LPS stimulus (10 ng/mL) for 3 hours, were incubated with MTT (Merck) solution for 1 hour at 37 °C, and then dimethyl sulfoxide (DMSO) was added to dissolve the formazan crystals. Similarly, CCD18Co cell viability (4 × 103 cells seeded in a 96-well plate) was measured by the MTT assay to test the viability in presence of AM9053 (0.03-10 μM) for 18 hours. Absorbances were read at 532 nm (iMark microplate reader, Bio-Rad, Segrate, Italy). All results were expressed as a percentage of cell viability.
2.14. Proliferation assay by BrdU incorporation
CCD-18Co, cultured in TGF-β (10 ng/mL), were seeded in 96-well plates (4 × 103 per well), allowed to adhere (within 24 hours), and starved by serum deprivation for 18 hours. Myofibroblasts were treated with noncytotoxic AM9053 concentrations (0.03-1 μM). After 18 hours of treatment, pulsing cells were incubated with BrdU (10 µM) in the cell medium for 2 hours. Thereafter, cell proliferation was determined using the BrdU proliferation enzyme-linked immunosorbent assay (ELISA) kit (Roche, Milan, Italy) according to the manufacturer’s instructions. All results were expressed as a percentage of cell proliferation.
2.15. Enzyme-linked immunosorbent assay
ELISA was performed on supernatants from BMDMs that were either pretreated with AM9053 (1 µM) for 1 hour or left untreated before LPS (10 ng/mL) exposure for 3 hours. Murine IL-23 was detected using the ELISA kit protocol, according to the manufacturer’s instructions (R&D, Minneapolis, USA). Data were expressed as cytokine quantity in picograms per milliliter (pg/mL).
2.16. Human biopsies
Ileocolonic biopsies were obtained from the surgical specimens of 10 patients, admitted for ileocolonic resection due to a CD diagnosis associated with strictures occlusions derived from intestinal fibrosis complication. The areas of the intestinal mucosa, defined as “healthy,” are referred to the adjacent nonstenotic zone of patients from which stenotic biopsies were taken (namely CD fibrotic). The study of human subject protocol abided by the Declaration of Helsinki principles was approved by the clinical research ethics committee of the University of Naples Federico II and A.O.R.N. Antonio Cardarelli (approval number 252). All patients enrolled in this study provided written informed consent.
2.17. Hydroxyproline assay
Hydroxyproline concentration is determined by the reaction of oxidized hydroxyproline with 4-(dimethylamino) benzaldehyde which results in a colorimetric (560 nm) product, proportional to hydroxyproline content, a major component of collagen. Hydroxyproline kit assay (Merck) was conducted according to the manufacturer’s instructions on human biopsies to ascertain fibrosis. Results were expressed as absorbance values at 560 nm.
2.18. Analysis of AE levels by liquid chromatography-atmospheric pressure chemical ionization-mass spectrometry
AE levels were analyzed in frozen tissues derived from murine colonic samples and human specimens, and BMDMs (1 × 106 in a 6-well plate). Frozen tissues were homogenized in a solution of chloroform/methanol/Tris-HCl 50 mM, pH 7.4 (2:1:1, by volume), containing 5 pmol of [2H]8-AEA, 50 pmol of [2H]4-PEA, and 50 pmol [2H]2-OEA (Cayman Chemicals, Vinci, Italy) as internal standards. BMDM supernatant was collected, and cells were scraped in 1 mL per well of methanol. Subsequently, cells and supernatant (1:1) were vortexed and immediately frozen at −80 °C. The extracts were purified by open-bed chromatography on silica gel, and the eluted fractions (90:10 by volume) containing AEA, PEA, and OEA were analyzed by liquid chromatography-atmospheric pressure chemical ionization-mass spectrometry (LC-APCI-MS) using a Shimadzu (Shimadzu, Kyoto, Japan) HPLC apparatus (LC-10ADVP) coupled to a Shimadzu (LCMS-2020) quadrupole MS via a Shimadzu APCI interface. LC-APCI-MS analyses of AEA, PEA, and OEA were performed in the selected ion monitoring (SIM) mode,45,46 using m/z values of 356 and 348 (molecular ion + 1 for deuterated and undeuterated AEA), 304 and 300 (molecular ion + 1 for deuterated and undeuterated PEA), and 328 and 326 (molecular ion + 1 for deuterated and undeuterated OEA). The AEA, PEA, and OEA levels were determined on the basis of their area ratio with the internal standard signal areas to provide the amounts in picomole per milligram of lipid extract.
2.19. Western blot
Whole cell lysates were obtained from BMDM cell line or tissue lysed with RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM EDTA, 0.25% sodium deoxycholate, 1 mM NaF, 10 μM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 10 μg/mL aprotinin, 10 μg/mL pepstatin, 10 μg/mL leupeptin) as previously described.47 Bio-Rad protein assay was used to determine proteins concentration (Bio-Rad, Hercules, CA, USA). Forty micrograms of whole lysates were resolved on 10% SDS-PAGE and proteins were transferred by blotting onto PVDF membranes. Membranes were incubated with anti-phospho-STAT3 Y705 antibody from Cell Signalling Technology (Cat. #9131) (Danvers, MA, USA) or anti-NAAA antibody from MyBioSource (Cat. #MBS2001655) (San Diego, CA, USA) and probed with appropriate horseradish peroxidase-conjugated secondary antibodies from Bioss Antibodies (Woburn, MA, USA). Proteins were visualized by enhanced chemiluminescence reagent (Amersham Biosciences, Buckinghamshire, UK) and were quantified using densitometry (Chemidoc, Bio-Rad). The same filters were re-probed with an anti-tubulin antibody from Santa Cruz Biotechnology (Cat. #sc-5274) (Irvine, CA, USA) to normalize the amount of loaded proteins.
2.20. RNA extraction and gene expression profiling by quantitative PCR
RNAs were extracted from (i) murine colons derived from the in vivo model of intestinal fibrosis chemically induced by TNBS, (ii) BMDMs, (iii) colon fibroblasts cultured with conditioned media from BMDM, and (iv) human intestinal fibrosis biopsies. Human and murine tissues were collected and stored in RNA later to stabilize and store RNAs (Thermo Fisher Scientific, USA). RNAs were extracted from (i) homogenized mice colon tissue using FastPrep (MP Biomedical, USA) in Purezol Reagent (Bio-Rad, Milan, Italy); (ii) BMDM in Purezol Reagent; (iii) colon fibroblasts cultured conditioned media from BMDM in Purezol Reagent; and (iv) human colon biopsies using RNeasy Mini Kit (Qiagen, Germany), all according to the manufacturer’s protocol. The quantification and quality analysis of RNA were performed using a NanoDrop One C spectrophotometer (Thermo Fisher Scientific, USA). Retro-transcription was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem, USA). Reverse transcription polymerase chain reaction (RT-qPCR) was performed using Fast SYBR Green Master Mix (Applied Biosystem, USA). Target gene expression calculation was normalized with respect to the reference housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin and expressed using the 2-ΔCt formula. All the genes analyzed are listed in Table 1.
| Targeted gene | Forward sequence (5ʹ-3ʹ) | Reverse sequence (5ʹ-3ʹ) |
|---|---|---|
| Sequences for Homo sapiens primers | ||
| COL2A1 | TGGACGATCAGGCGAAACC | GCTGCGGATGCTCTCAATCT |
| COL3A1 | TTGAAGGAGGATGTTCCCATCT | ACAGACACATATTTGGCATGGTT |
| GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
| IL-23A | CTCAGGGACAACAGTCAGTTC | ACAGGGCTATCAGGGAGCA |
| NAAA | GCCTTTATCTCGTTCATCACCAG | TGACAGTGGATGTGCAATTCT T |
| TGF β | CTAATGGTGGAAACCCACAACG | TATCGCCAGGAATTGTTGCTG |
2.21. Statistical analysis
The study was designed to generate groups of equal size, using randomization and blinded analysis. All data were expressed as mean ± SEM, and GraphPad Prism 8 software (USA) was used to perform statistical analysis. Outliers were identified by the ROUT test. To determine differences between the 2 group’s comparisons, data were tested using unpaired, paired Student’s t test, and/or Mann-Whitney test. For multiple group comparisons, data were compared via ONE-way analysis of variance (ANOVA) with Dunnett’s post hoc test and/or with Tukey’s post hoc test analysis. A p-value <0.05 was considered significant.
3. Results
3.1. AE degradative enzyme NAAA is upregulated in stenotic colonic tissues of CD patients accompanied with a reduction of its substrates
To investigate the potential pathogenic role of NAAA in intestinal fibrosis, we collected ileocolonic paired samples from both stenotic and nonstenotic control areas derived from patients diagnosed with CD and analyzed for the expression of the AEs hydrolytic enzyme NAAA. We began with fibrotic characterization of tissues and found that hydroxyproline quantification assay significantly confirmed the increase of collagen deposition in stenotic areas compared to nonstenotic areas of the same CD patients (Figure 1A). Moreover, quantitative PCR analysis of fibrotic tissues showed increased expression of several fibrotic markers such as COL2A1 (Figure 1B), COL3A1 (Figure 1C), TGF-β (Figure 1D), and IL-23 (Figure 1E). NAAA expression was investigated by qRT-PCR (Figure 1F) and western blot analysis (Figure 1G and H) and NAAA was upregulated only at protein level in fibrotic CD tissues (Figure 1G and H). NAAA upregulation was associated with a significant decrease in PEA (Figure 1I) and OEA levels (Figure 1J) (ie, its preferential substrates), with a nonsignificant trend toward the decrease in AEA levels (Figure 1K). Taken together, these data strongly support the hypothesis that AEs signaling plays a crucial role in human intestinal fibrosis, pointing on the key relevance of NAAA (ie, AE degradative enzyme) in the disease.
3.2. NAAA pharmacological inhibition improves intestinal fibrosis in vivo
Human data revealed the increased expression of NAAA, suggesting its potential functional role in fibrosis. To investigate NAAA relevance in the intestinal fibrogenic mechanism, we adopted the TNBS mouse model of fibrosis, which has been frequently used to model intestinal fibrosis of CD.34 To assess the pharmacological effect of NAAA inhibition, we administered AM9053, a selective, potent, and slowly reversible NAAA inhibitor (IC50 = 30 nM).35 To ascertain intestinal inflammation and fibrosis, we firstly considered the DAI and the MEICS. We observed a significant increase in both DAI and MEICS in fibrotic mice, but these were significantly reduced in mice treated with the NAAA inhibitor AM9053 (Figure 2A and B). Endoscopic images took at the end of the experimental procedure corroborated the antifibrotic effect of AM9053 (reported at the top of Figure 2B). Intestinal inflammation was further confirmed by H&E staining showing that TNBS determined a profound inflammation of the colon wall in terms of change in the shape of intestinal glands and in the number of inflammatory cells into the lamina propria, partially reverted by AM9053 (Figure 2C, upper panel). Masson’s trichrome staining revealed an increased deposition of collagen localized at the submucosal layers that was restored by NAAA inhibition (Figure 2C, middle panel). Proliferation of α-SMA-positive myofibroblasts is a well-defined feature in Crohn’s fibrosis indicating activation of fibroblasts.48 Confocal analysis and related quantification revealed a significant accumulation of α-SMA-positive cells in the colon of TNBS-treated mice that was not significantly reduced in the colon of mice treated with AM9053 (Figure 2C, lower panel and 2D).
In subsequent studies, we quantified some of the main genes involved in fibrogenic mechanisms namely COL2A1 (Figure 2E), COL3A1 (Figure 2F), and IL-23 (Figure 2G). TNBS determined upregulation of profibrotic genes that were all significantly reverted after AM9053 treatment (Figure 2E-G), corroborating the hypothesis that NAAA inhibition prevented the induction of fibrosis. Next, we moved to quantify the protein expression of phosphorylated Tyr-705-STAT3 in fibrotic colons, with or without treatment with the NAAA inhibitor, due to its role in aberrant fibroblast activation.49 We found a significant reduction of pSTAT3 upon AM9053 treatment, thus pinpointing the antifibrotic effects of NAAA pharmacological inhibition (Figure 2H). Of interest, we also analyzed AM9053 effects on epithelial-to-mesenchymal transition (EMT), which is known to support pathogenesis of IBD-associated intestinal fibrosis.50 Quantitative PCR analysis of the colonic tissues from TNBS-treated mice revealed increased expression of TGF-β, a profibrogenic and EMT mediator cytokine (Figure 2I), and Vimentin, a mesenchymal marker (Figure 2J), accompanied by decreased expression of the epithelial gene E-cadherin (Figure 2K). Collectively, these results suggest an increased activation of EMT after chronic TNBS treatment and restoration of TGF-β, Vimentin, and E-cadherin to control levels following AM9053 treatment (Figure 2I-K). Finally, we also analyzed the expression of EMT-orchestrating transcription factors, such as Slug (Figure 2L), SNA1 (Figure 2M), and Twist (Figure 2N), in the colonic tissues of fibrotic mice. We found a significant increase in the Slug gene only in fibrotic mice, which was downregulated in AM9053-treated mice (Figure 2L).
In summary, we conclude that NAAA pharmacological inhibition counteracts intestinal fibrosis in vivo by reducing general inflammatory parameters, collagen deposition, and key genes related to fibrosis. Importantly, we also suppose that AM9053 antifibrotic effects may be also due, at least in part, by a reduction of pSTAT3 and in EMT-supporting gut fibrosis.
3.3. The NAAA inhibitor AM9053 influences Th subsets in MLNs
To clarify whether NAAA pharmacological inhibition was linked to changes in immune signature, we analyzed immune cells from MLNs by flow cytometry collected at the day of the sacrifice. We counted the immune cells isolated (Figure 3A) and then proceeded for their staining and characterization as follows: CD3+, cytotoxic T cells (CD8+), and T-helper cell subsets (Th1: CD4+/IFN-γ+; Th17: CD4+/IL-17+; Treg: CD4+/CD25+/FoxP3+; Th2: CD4+/IL-4+) (gating strategy and setting for positive populations are shown in Supplementary Figures 1 and 2). As expected, fibrotic mice showed an inflammatory profile in terms of significant increase in the total number of isolated immune cells (Figure 3A), CD3+ cells (Figure 3B), cytotoxic T cells CD8+ (Figure 3C), T-helper CD4+ cells (Figure 3D), and their subpopulations Th1: CD4+/IFN-γ+ (Figure 3E and F) and Th17: CD4+/IL-17+ (Figure 3G and H) associated with a significant reduction of anti-inflammatory Treg population, that is, CD4+/CD25+/FoxP3+ (Figure 3I and J). NAAA selective inhibition by AM9053 significantly restored the cell population changes caused by TNBS to the control levels (Figure 3A-J). We did not observe an increase in Th2 cells CD4+/IL-4+ in fibrotic mice (Figure 3K and L), which is in line with the knowledge that TNBS induces experimental colitis with dominant Th1-type immune response that more closely resembles CD.51 Altogether, these results indicate that NAAA pharmacological inhibition ameliorates chronic inflammation through the modulation of the quality and quantity of the immune response.
3.4. NAAA is upregulated in fibrotic mice
Accordingly with the human data, we found that TNBS fibrotic mice showed a significant augmented expression of NAAA (Figure 4A), and this condition did not affect AE levels (ie, AEA, PEA, and OEA) (Figure 4B-D). Importantly, NAAA inhibition significantly increased only PEA levels (Figure 4B) with no changes recorded in OEA or AEA as well as in NAAA expression (Figure 4A-D).
Taken together, these results strengthen the evidence that NAAA is upregulated in fibrotic conditions in mice, which corroborates its involvement in gut fibrosis.
3.5. The antifibrotic actions of NAAA inhibition are mediated by naive Mφ and M2 macrophages that in turn indirectly affect fibroblast collagenogenesis
To specifically identify cellular populations responsible of the control of gut fibrosis responses under NAAA inhibition, we first investigated its effects in fibroblasts, main actors of fibrogenic mechanisms. To further examine the potential effect of AM9053 on fibroblasts, we tested it on immortalized human colon fibroblasts namely CCD-18Co cells cultured in the presence of TGF-β. AM9053, used at noncytotoxic concentrations (Supplementary Figure 3A), did not modify CCD-18Co cell proliferation (Supplementary Figure 3B). These results further confirm the involvement of fibroblasts in fibrosis, but they are not directly involved in the antifibrotic outcomes induced by NAAA inhibition. Macrophages are critical regulators of fibrosis development.52 To investigate the effect of NAAA inhibition on macrophages, we isolated primary colonic fibroblasts and cultured with paired conditioned media from either naive Mφ BMDMs or those polarized into M1 and M2, with or without pretreatment with the NAAA inhibitor AM9053, as described in Figure 5A. RT-qPCR analysis of some key genes involved in collagenogenesis, namely COL1A1, COL3A1, COL4A1, and Fibronectin, revealed that NAAA inhibition did not affect these markers in unstimulated fibroblasts (Figure 5B-E), with the only acceptation for COL3A1 (Figure 5C). Importantly, pretreatment with the NAAA inhibitor was able to suppress the expression of collagenogenesis markers (Figure 5B-E) in fibroblasts cultured with conditioned media only from naive Mφ and M2 macrophages. Overall, these data suggest that NAAA inhibition mediates antifibrotic effects through Mφ and M2 macrophages that in turn act in reducing collagenogenesis in fibroblasts, de facto excluding a solely effects on fibroblasts.
3.6. AM9053 inhibits IL-23 pathway in BMDMs
The above data revealed that NAAA inhibition strongly neutralized the expression of IL-23 gene in fibrotic tissues (Figure 2F) associated with a significant reduction of Th17 cells in isolated MLNs (Figure 3G and H). Moreover, the antifibrotic actions of NAAA inhibition are mediated by macrophages that in turn indirectly affect fibroblast collagenogenesis (Figure 5). We next moved in depicting the effects of AM9053 on IL-23 on BMDMs. Firstly, we quantified AE levels upon NAAA inhibition, and the results showed that AM9053 led to an increase in OEA levels only (Figure 6A-C) with no changes recorded in untreated LPS-loaded BMDMs (Figure 6A-C). In confirmation with literature data that report a substantial increase in IL-23 following 3 hours of LPS challenge (10 ng/mL),12 we found that LPS significantly increased IL-23 levels both at RNA and protein levels (Figure 6D and E). Importantly, AM9053, at a noncytotoxic concentration (Supplementary Figure 5), reduced IL-23 expression and secretion in BMDMs (Figure 6D and E). Thereafter, to depict the pharmacological mechanism of action underlying the effect of NAAA inhibition on IL-23, we analyzed the expression of the main players involved in the IL-23 signaling. NAAA inhibition reduced the gene expression of TGF-β (Figure 6F), IL-1β (Figure 6G), IL-6 (Figure 6H), TNF-α (Figure 6I), IL-17A (Figure 6J), IL-17RC (Figure 6K), and RORγT (Figure 6L), all of which were upregulated by LPS (Figure 6D-L). The production of IL-17 and RORγT has been already reported in macrophages upon IL-23 stimulation.53 Lastly, since IL-23 signaling preferentially induces the phosphorylation and activation of STAT3, we also investigated the effect of AM9053 on its protein expression. Of importance, NAAA inhibition significantly reduced pSTAT3 protein expression (similar to the in vivo studies), compared to LPS-treated BMDMs (Figure 6M). These data strongly sustain the idea that the beneficial effects of NAAA inhibition in intestinal fibrosis are due, at least in part, to a mechanism involving IL-23 signaling.
3.7. NAAA inhibition reduces the induction of IL-23 in lamina propria CX3CR1+ mononuclear phagocytes
Having demonstrated that the antifibrotic effects of NAAA are due to macrophages by affecting IL-23 signaling pathway, we next determined whether these effects are also reflected in lamina propria CX3CR1+ mononuclear phagocytes, which have been previously reported to be involved in intestinal fibrosis and major producers of IL-23 within the gut.12 Therefore, we characterized macrophage populations according to the expression of CX3CR1, MHCII, and Ly6c markers defined as P2, P3, and P4 (as reported in the representative Figure 7A). As shown in Figure 7A, the P4 macrophage population (MHCIIhi/CX3CR1hi/Ly6clow) showed significant increased frequency in AM9053-treated mice, while no significant differences were observed in the frequency of P2 (MHCIIhi/CX3CR1int/Ly6Chi) and P3 (MHCIIhi/CX3CR1int/Ly6Clow) resident mononuclear phagocytes in the colon tissue (Figure 7A and B). Furthermore, we investigated whether AM9053 could influence IL-23 expression in CX3CR1+ subsets by performing FACS analyses for characterization. We selected the CX3CR1+ macrophage population according to the expression of CD45, CD11b, and F4/80 markers (as reported in Supplementary Figure 4). Our results revealed that AM9053 was able to significantly reduce IL-23 expression in both macrophage populations Cd11b+/F480+/CX3CR1+int and Cd11b+/F480+/CX3CR1+hi (Figure 7C and D). Together, our data demonstrate that NAAA inhibition reduced the frequency of CX3CR1+ population more involved in tissue remodeling and anti-inflammatory response as well as reduced IL-23 release in CX3CR1+ macrophages, likely providing protection against intestinal fibrosis.
4. Discussion
NAAA, the main degradative enzyme of AEs, has been extensively recognized as a potential therapeutic target for pain and inflammation,32 although its functional role in diseases is fragmentary.35,54 Here, we demonstrated, for the first time, that NAAA is involved in intestinal fibrosis, a frequent long-term complication of IBD with no antifibrotic therapies available so far.14 Several lines of evidence support our hypothesis. We found that NAAA is highly expressed in stenotic CD patients as well as in mice with experimental fibrosis. NAAA upregulation was accompanied by an increase in OEA and PEA levels (ie, its preferential substrates)32 in the colon of stenotic patients. These expression changes are likely functionally relevant as suggested by the findings that administration of the systemically active NAAA inhibitor AM9053 in fibrotic mice determines antifibrotic effects, in terms of a reduction in general inflammatory parameters, collagen deposition, fibrotic markers, EMT and STAT3 expressions, immune cells in MLNs, collagenogenesis markers in primary colonic fibroblasts cultured in presence of conditioned media derived from naive Mφ and M2 macrophages, and, markedly important, attenuation of IL-23 in both bone marrow macrophages and in isolated lamina propria CX3CR1+ mononuclear phagocytes. Thus, we have firstly provided compelling evidence that NAAA is involved in intestinal fibrosis and its pharmacological blockade neutralizes IL-23 that, in turn, likely prevents fibrosis. Our findings may be of translational relevance in consideration of the primary clinical importance of IL-23 inhibitors in the context of fibrotic autoimmunity diseases,13 thus providing new approaches to treating fibrosis-based diseases including those affecting the gut. Noteworthy, it is already known that OEA and/or PEA modulate colitis in animals,55–57 and PEA also regulates the development of intestinal radiation injury.25 However, these lipid molecules have therapeutic limitations because of their rapid enzymatic degradation and poor bioavailability.
Important from a translational point of view, we started with the characterization of NAAA in human CD fibrotic biopsies. Ileocolonic CD strictures obtained from surgical resections were firstly characterized for collagen deposition and expression of fibrotic markers (ie, COL2A1, COL3A1, TGF-β, and IL-23). NAAA protein expression was significantly upregulated in stenotic areas (compared to the nonstenotic areas paired samples of the same patients), accompanied by a strong decrease in the levels of its preferential substrates OEA and PEA. These data strongly support that NAAA may have a functional role in gut fibrosis and that NAAA inhibition plays a pathophysiological role in the intestinal fibrogenic process, thus enforcing the initial hypothesis of the study.
As a test of the idea that NAAA blockade may exert antifibrotic effects, in this study we selectively inhibited NAAA by using AM9053, which is well known to exert intestinal anti-inflammatory effects in acute TNBS colitis58 as well as antitumoral35 actions in mice. In our study, AM9053 exerts antifibrotic effects in vivo by reducing both general inflammatory parameters and specific markers such as collagen deposition, and fibrotic and EMT markers. Consistent with human data, NAAA was upregulated in fibrotic mice compared to healthy animals, suggesting a potential pathogenic relevance of NAAA in this disease, and its inhibition by AM9053 results in increased PEA levels in fibrotic intestinal tissues and OEA augmentation in BMDMs. Our results (ie, selective increase in PEA and/or OEA levels following NAAA inhibition) are in line with previous experimental studies,58 reinforcing the concept that NAAA inhibition determines an increase in AE levels that is tissue and pathology specific.32 For example, others have demonstrated that AM9053 more markedly increased OEA levels in murine immortalized LPS-treated macrophages and/or colonic tumoral tissues.35,59
The main effector cells that mediate intestinal fibrosis are considered to be myofibroblasts, which are responsible for the synthesis of several ECM proteins, among which collagen plays a leading role.60 α-SMA is a well-defined fibroblasts marker, which is known to be correlated to organ fibrosis.48 In our study, confocal analysis revealed a significant increase in α-SMA in fibrotic colonic tissues, which is suggestive of myofibroblasts hyperactivation. Interestingly, AM9053 did not modify α-SMA expression as well as did not influence CCD-18Co cell proliferation (ie, immortalized human colonic fibroblasts) cultured with TGF-β. Overall, these data suggest that fibroblasts do not play a crucial role in the antifibrotic effect of NAAA inhibition. We assume that the lack of effect of NAAA inhibition on myofibroblasts may be due, at least in part, to the fact that NAAA is mainly expressed in immune cells, such as monocytes and macrophages.31,61 Having excluded the effects of NAAA inhibition on fibroblasts and to understand which cells are responsible of NAAA inhibition effects on collagen deposition, we next focused on macrophages, critical regulators of fibrosis development by influencing cell cross-talk, including fibroblasts-inducing fibrogenesis. Importantly, macrophages and fibroblasts do not influence each other when interacting in resting conditions, thus suggesting that cellular contacts without external stimuli are insufficient to induce major phenotype/functional changes.52 Also of importance in our context, NAAA is mainly expressed in immune cells including macrophages.31,61 To investigate on this matter, we performed experiments in which primary colonic fibroblasts were grown in conditioned media from naive and/or polarized BMDMs pharmacologically pretreated with the NAAA inhibitor AM9053. Importantly, we demonstrated that the pretreatment with the NAAA inhibitor was able to suppress the expression of collagenogenesis markers. These data suggested that the antifibrotic effects of NAAA inhibitor involve naive Mφ and M2 macrophages that, in turn, act in reducing collagenogenesis in fibroblasts. We hypothesize that this effect is likely due to the observed increase in OEA levels in BMDMs; however, further investigation is needed to fully understand this mechanism. The effects only on naive Mφ and M2 macrophages are in line with the recent notion that naive Mφ and M2 macrophages are together and uniquely classified as gut-resident macrophages and M2 markers are closely related to the Mφ phenotype.62
IL-23 is a leading cytokine involved in immune-mediated chronic inflammatory diseases,63 including intestinal fibrosis.12 IL-23 acts as a pleiotropic cytokine, secreted by macrophages and dendritic cells, that is crucial in host defence maintenance. Indeed, IL-23 is essential for the differentiation of Th17 lymphocytes as well as Th1/Th17 balance63 and is inversely correlated to colonic Treg cell frequency.64 Our study revealed that NAAA inhibition neutralized IL-23 levels in mice fibrotic colonic tissues and it normalized several factors correlated with IL-23 hyperproduction, such as, naive CD4+ cells, Th17, and Treg cells in MLNs. The hypothesis that IL-23 is involved in AM9053 antifibrotic effects is further supported by previous results showing that BMDMs highly express NAAA31 and produce high amounts of IL-23.63 In mice, exposure to TGF-β, IL-1, and IL-6 induces the expression of retinoic acid receptor-related orphan receptor-γt (RORγt), a lineage-specific transcription factor that promotes the expression of IL-23 and IL-17A. In turn, IL-23 predominantly activates STAT365 that stabilizes the expression of genes controlling T-cell activation, although STAT3 activation is not only restricted to IL-23.66 We observed that AM9053 significantly reduced IL-23 levels following LPS exposure in BMDMs12 as well as several cytokines/factors belonging to IL-23 signaling pathway, such as TGF-β, IL-1β, IL-6, TNF-α, RORγt, and IL-17A/RC in LPS-exposed BMDMs. The activation of STAT3 upon LPS treatment in macrophages is critically reported to sustain inflammatory responses.67 Moreover, the hypothesis that AM9053 acts via IL-23 is reinforced by the reduction of the expression of STAT3, likely due to reduction in IL-23 levels. In further support of this conclusion, pSTAT3 is known to control the activation of T-cells,65 and we have also demonstrated that NAAA inhibition impacted Th1 cell population. The direct connection of IL-23/STAT3 pathway in fibrosis has been recently reported in which the sustained IL-23R activation consequently amplifies STAT3 signaling that exacerbates the fibrotic niche in renal fibroblasts.68
To finally demonstrate the effectiveness of NAAA inhibition on IL-23 release from macrophages, we ultimately analyzed the effects of AM9053 in lamina propria CX3CR1+ mononuclear phagocytes. CX3CR1+ cells are tissue-resident mononuclear phagocytes located close to the epithelium69 that represent the major source of IL-23 in colitis and gut fibrosis.12 In fact, a specific depletion of CX3CR1+ cells resulted in significantly decreased concentration of the circulating IL-23 with consequential amelioration of inflammation.70 We importantly observed that AM9053 increased the frequency of the mature CX3CR1+ cells, characterized as P4 population (MHCIIhi/CX3CR1hi/Ly6clow), which are known to have effects in tissue remodeling, epithelial renewal, anti-inflammatory IL-10 production, and local maintenance of Treg.71 Remarkably, NAAA inhibition neutralized the expression of IL-23 in CX3CR1+ macrophages (Cd11b+/F480+/CX3CR1+int and Cd11b+/F480+/CX3CR1+hi). Overall, these data reinforce the idea that the antifibrotic effects of AM9053 are due to the neutralization of IL-23 in macrophages. In further support of this conclusion, NAAA pharmacological inhibition, by acting on mononuclear phagocytes, prevented the development of psoriasis, a well-known IL-23-based disease.54
Based on our studies, we conclude that NAAA is functionally relevant for intestinal fibrosis, and its blockade results in antifibrotic effects through IL-23 signaling. Overall, our findings provide new insights into the pathophysiological mechanisms of intestinal fibrosis, pointing on the potential use of NAAA inhibitors for eventual therapeutic treatments.
Supplementary Data
Supplementary data are available online at ECCO-JCC online.
Contributor Information
Maria Francesca Nanì, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Ester Pagano, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Paola De Cicco, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Giuseppe Lucariello, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Fabio Cattaneo, Department of Molecular Medicine and Medical Biotechnology, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Francesca Paola Tropeano, Department of Clinical Medicine and Surgery, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Donatella Cicia, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Rebecca Amico, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Federica Raucci, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Giuseppe Ercolano, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Francesco Maione, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Maria Michela Rinaldi, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Fabiana Esposito, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Rosario Ammendola, Department of Molecular Medicine and Medical Biotechnology, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Gaetano Luglio, Department of Clinical Medicine and Surgery, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Raffaele Capasso, Department of Agricultural Sciences, University of Naples Federico II, Portici, Italy.
Alexandros Makriyannis, Center for Drug Discovery and Department of Pharmaceutical Sciences, Northeastern University, Boston, MA, USA.
Stefania Petrosino, Institute of Biomolecular Chemistry, National Research Council, Pozzuoli, Italy; Epitech Group SpA, Saccolongo, Italy.
Francesca Borrelli, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Barbara Romano, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Angelo A Izzo, Department of Pharmacy, School of Medicine and Surgery, University of Naples Federico II, Naples, Italy.
Acknowledgments
Graphical abstract and image figure 5A were Created with BioRender.com.
Funding
This work was supported by grants from the European Union—NextGenerationEU (PNRR M4C2-Investimento 1.4-CN00000041-PNRR_CN3RNA_SPOKE9), Italian Ministry of Health (Progetti di Rilevanza Nazionale, PRIN 2022; code numbers 2022NLLBWT and 2022J5ZL4B), and DA 9158 from the US National Institutes of Health, National Institute on Drug Abuse.
Conflict of Interest
None declared.
Data Availability
The data used to support the findings of this study are available from the corresponding author upon request.
References
Untitled section
References
- 1. Wang J, Lin S, Brown JM, van Wagoner D, Fiocchi C, Rieder F. Novel mechanisms and clinical trial endpoints in intestinal fibrosis. Immunol Rev 2021;302:211–27.
- 2. Speca S, Giusti I, Rieder F, Latella G. Cellular and molecular mechanisms of intestinal fibrosis. World J Gastroenterol 2012;18:3635–61.
- 3. Alfredsson J, Wick MJ. Mechanism of fibrosis and stricture formation in Crohn’s disease. Scand J Immunol 2020;92:e12990.
- 4. Costa C, Sampaio-Maia B, Araujo R, et al. Gut microbiome and organ fibrosis. Nutrients 2022;14:352.
- 5. Rieder F, Fiocchi C, Rogler G. Mechanisms, management, and treatment of fibrosis in patients with inflammatory bowel diseases. Gastroenterology 2017;152:340–50.e6.
- 6. D’Haens G, Rieder F, Feagan BG, et al. ; International Organization for Inflammatory Bowel Disease Fibrosis Working Group. Challenges in the pathophysiology, diagnosis, and management of intestinal fibrosis in inflammatory bowel disease. Gastroenterology 2022;162:26–31.
- 7. Paul J, Singh AK, Kathania M, et al. IL-17-driven intestinal fibrosis is inhibited by itch-mediated ubiquitination of HIC-5. Mucosal Immunol 2018;11:427–36.
- 8. de Lange KM, Moutsianas L, Lee JC, et al. Genome-wide association study implicates immune activation of multiple integrin genes in inflammatory bowel disease. Nat Genet 2017;49:256–61.
- 9. Hue S, Ahern P, Buonocore S, et al. Interleukin-23 drives innate and T cell-mediated intestinal inflammation. J Exp Med 2006;203:2473–83.
- 10. Eken A, Singh AK, Oukka M. Interleukin 23 in Crohn’s disease. Inflamm Bowel Dis 2014;20:587–95.
- 11. Fuss IJ, Becker C, Yang Z, et al. Both IL-12p70 and IL-23 are synthesized during active Crohn’s disease and are down-regulated by treatment with anti-IL-12 p40 monoclonal antibody. Inflamm Bowel Dis 2006;12:9–15.
- 12. Mathur R, Alam MM, Zhao XF, et al. Induction of autophagy in Cx3cr1(+) mononuclear cells limits IL-23/IL-22 axis-mediated intestinal fibrosis. Mucosal Immunol 2019;12:612–23.
- 13. Parigi TL, Iacucci M, Ghosh S. Blockade of IL-23: what is in the pipeline? J Crohns Colitis 2022;16:ii64–72.
- 14. D’Alessio S, Ungaro F, Noviello D, Lovisa S, Peyrin-Biroulet L, Danese S. Revisiting fibrosis in inflammatory bowel disease: the gut thickens. Nat Rev Gastroenterol Hepatol 2022;19:169–84.
- 15. Hwang S, Chung KW. Targeting fatty acid metabolism for fibrotic disorders. Arch Pharm Res 2021;44:839–56.
- 16. Mock ED, Gagestein B, van der Stelt M. Anandamide and other N-acylethanolamines: a class of signaling lipids with therapeutic opportunities. Prog Lipid Res 2023;89:101194.
- 17. Schiano Moriello A, Roviezzo F, Iannotti FA, et al. First evidence of the protective effects of 2-pentadecyl-2-oxazoline (pea-oxa) in in vitro models of acute lung injury. Biomolecules 2022;13:33.
- 18. Hu J, Ying H, Yao J, et al. Micronized palmitoylethanolamide ameliorates methionine- and choline-deficient diet-induced nonalcoholic steatohepatitis via inhibiting inflammation and restoring autophagy. Front Pharmacol 2021;12:744483.
- 19. Pryimak N, Zaiachuk M, Kovalchuk O, Kovalchuk I. The potential use of cannabis in tissue fibrosis. Front Cell Dev Biol 2021;9:715380.
- 20. Fusco R, Cordaro M, Genovese T, et al. Adelmidrol: a new promising antioxidant and anti-inflammatory therapeutic tool in pulmonary fibrosis. Antioxidants (Basel) 2020;9:601.
- 21. Ye S, Chen Q, Jiang N, et al. Pparalpha-dependent effects of palmitoylethanolamide against retinal neovascularization and fibrosis. Invest Ophthalmol Vis Sci 2020;61:15.
- 22. Melgar-Lesmes P, Perramon M, Jimenez W. Roles of the hepatic endocannabinoid and apelin systems in the pathogenesis of liver fibrosis. Cells 2019;8:1311.
- 23. Francois H, Lecru L. The role of cannabinoid receptors in renal diseases. Curr Med Chem 2018;25:793–801.
- 24. Ohara M, Ohnishi S, Hosono H, et al. Palmitoylethanolamide ameliorates carbon tetrachloride-induced liver fibrosis in rats. Front Pharmacol 2018;9:709.
- 25. Wang J, Zheng J, Kulkarni A, et al. Palmitoylethanolamide regulates development of intestinal radiation injury in a mast cell-dependent manner. Dig Dis Sci 2014;59:2693–703.
- 26. Lin L, Mabou Tagne A, Squire EN, et al. Diet-induced obesity disrupts histamine-dependent oleoylethanolamide signaling in the mouse liver. Pharmacology 2022;107:423–32.
- 27. Chen L, Li L, Chen J, et al. Oleoylethanolamide, an endogenous PPAR-alpha ligand, attenuates liver fibrosis targeting hepatic stellate cells. Oncotarget 2015;6:42530–40.
- 28. Palumbo-Zerr K, Horn A, Distler A, et al. Inactivation of fatty acid amide hydrolase exacerbates experimental fibrosis by enhanced endocannabinoid-mediated activation of cb1. Ann Rheum Dis 2012;71:2051–4.
- 29. Genovese T, Duranti A, D’Amico R, et al. Fatty acid amide hydrolase (FAAH) inhibition plays a key role in counteracting acute lung injury. Int J Mol Sci 2022;23:2781.
- 30. Piomelli D, Scalvini L, Fotio Y, et al. N-acylethanolamine acid amidase (NAAA): structure, function, and inhibition. J Med Chem 2020;63:7475–90.
- 31. Tsuboi K, Sun YX, Okamoto Y, Araki N, Tonai T, Ueda N. Molecular characterization of n-acylethanolamine-hydrolyzing acid amidase, a novel member of the choloylglycine hydrolase family with structural and functional similarity to acid ceramidase. J Biol Chem 2005;280:11082–92.
- 32. Bottemanne P, Muccioli GG, Alhouayek M. N-acylethanolamine hydrolyzing acid amidase inhibition: tools and potential therapeutic opportunities. Drug Discov Today 2018;23:1520–9.
- 33. West JM, Zvonok N, Whitten KM, Wood JT, Makriyannis A. Mass spectrometric characterization of human n-acylethanolamine-hydrolyzing acid amidase. J Proteome Res 2012;11:972–81.
- 34. Wirtz S, Popp V, Kindermann M, et al. Chemically induced mouse models of acute and chronic intestinal inflammation. Nat Protoc 2017;12:1295–309.
- 35. Romano B, Pagano E, Iannotti FA, et al. N-acylethanolamine acid amidase (NAAA) is dysregulated in colorectal cancer patients and its inhibition reduces experimental cancer growth. Br J Pharmacol 2022;179:1679–94.
- 36. Becker C, Fantini MC, Neurath MF. High resolution colonoscopy in live mice. Nat Protoc 2006;1:2900–4.
- 37. Lee HS, Jang MS, Kim JH, et al. Ulmus davidiana var. japonica Nakai upregulates eosinophils and suppresses Th1 and Th17 cells in the small intestine. PLoS One 2013;8:e76716.
- 38. Yang X, Yang Y, Wang Y, et al. Excretory/secretory products from Trichinella spiralis adult worms ameliorate DSS-induced colitis in mice. PLoS One 2014;9:e96454.
- 39. Xu M, Duan XY, Chen QY, et al. Effect of compound sophorae decoction on dextran sodium sulfate (DSS)-induced colitis in mice by regulating Th17/Treg cell balance. Biomed Pharmacother 2019;109:2396–408.
- 40. Vellecco V, Saviano A, Raucci F, et al. Interleukin-17 (IL-17) triggers systemic inflammation, peripheral vascular dysfunction, and related prothrombotic state in a mouse model of Alzheimer’s disease. Pharmacol Res 2023;187:106595.
- 41. Ying W, Cheruku PS, Bazer FW, Safe SH, Zhou B. Investigation of macrophage polarization using bone marrow derived macrophages. J Vis Exp 2013;76:50323.
- 42. Neufert C, Becker C, Tureci O, et al. Tumor fibroblast-derived epiregulin promotes growth of colitis-associated neoplasms through ERK. J Clin Invest 2013;123:1428–43.
- 43. Honzawa Y, Nakase H, Shiokawa M, et al. Involvement of interleukin-17A-induced expression of heat shock protein 47 in intestinal fibrosis in Crohn’s disease. Gut 2014;63:1902–12.
- 44. Buranaamnuay K. The MTT assay application to measure the viability of spermatozoa: a variety of the assay protocols. Open Vet J 2021;11:251–69.
- 45. Di Marzo V, Goparaju SK, Wang L, et al. Leptin-regulated endocannabinoids are involved in maintaining food intake. Nature 2001;410:822–5.
- 46. Marsicano G, Wotjak CT, Azad SC, et al. The endogenous cannabinoid system controls extinction of aversive memories. Nature 2002;418:530–4.
- 47. Ammendola R, Parisi M, Esposito G, Cattaneo F. Pro-resolving FPR2 agonists regulate NADPH oxidase-dependent phosphorylation of HSP27, OSR1, and MARCKS and activation of the respective upstream kinases. Antioxidants (Basel) 2021;10:134.
- 48. Sun KH, Chang Y, Reed NI, Sheppard D. Alpha-smooth muscle actin is an inconsistent marker of fibroblasts responsible for force-dependent TGFbeta activation or collagen production across multiple models of organ fibrosis. Am J Physiol Lung Cell Mol Physiol 2016;310:L824–36.
- 49. Chakraborty D, Sumova B, Mallano T, et al. Activation of STAT3 integrates common profibrotic pathways to promote fibroblast activation and tissue fibrosis. Nat Commun 2017;8:1130.
- 50. Scharl M, Huber N, Lang S, Fürst A, Jehle E, Rogler G. Hallmarks of epithelial to mesenchymal transition are detectable in Crohn’s disease associated intestinal fibrosis. Clin Transl Med 2015;4:1.
- 51. Dohi T, Fujihashi K, Kiyono H, Elson CO, McGhee JR. Mice deficient in Th1- and Th2-type cytokines develop distinct forms of hapten-induced colitis. Gastroenterology 2000;119:724–33.
- 52. Setten E, Castagna A, Nava-Sedeno JM, et al. Understanding fibrosis pathogenesis via modeling macrophage-fibroblast interplay in immune-metabolic context. Nat Commun 2022;13:6499.
- 53. Hou Y, Zhu L, Tian H, et al. IL-23-induced macrophage polarization and its pathological roles in mice with imiquimod-induced psoriasis. Protein Cell 2018;9:1027–38.
- 54. Li Y, Li Y, Xu S, et al. Corrigendum to “N-acylethanolamine acid amidase (NAAA) exacerbates psoriasis inflammation by enhancing dendritic cell (DCS) maturation” [Pharm. Res. 185 (2022) 1-16/yphrs_106491]. Pharmacol Res 2022;185:106527.
- 55. Esposito G, Capoccia E, Turco F, et al. Palmitoylethanolamide improves colon inflammation through an enteric glia/Toll like receptor 4-dependent PPAR-alpha activation. Gut 2014;63:1300–12.
- 56. Borrelli F, Romano B, Petrosino S, et al. Palmitoylethanolamide, a naturally occurring lipid, is an orally effective intestinal anti-inflammatory agent. Br J Pharmacol 2015;172:142–58.
- 57. Lama A, Provensi G, Amoriello R, et al. The anti-inflammatory and immune-modulatory effects of OEA limit DSS-induced colitis in mice. Biomed Pharmacother 2020;129:110368.
- 58. Alhouayek M, Bottemanne P, Subramanian KV, et al. N-acylethanolamine-hydrolyzing acid amidase inhibition increases colon n-palmitoylethanolamine levels and counteracts murine colitis. FASEB J 2015;29:650–61.
- 59. Alhouayek M, Bottemanne P, Makriyannis A, Muccioli GG. N-acylethanolamine-hydrolyzing acid amidase and fatty acid amide hydrolase inhibition differentially affect N-acylethanolamine levels and macrophage activation. Biochim Biophys Acta Mol Cell Biol Lipids 2017;1862:474–84.
- 60. Rieder F, Fiocchi C. Intestinal fibrosis in IBD—a dynamic, multifactorial process. Nat Rev Gastroenterol Hepatol 2009;6:228–35.
- 61. Ribeiro A, Pontis S, Mengatto L, et al. A potent systemically active n-acylethanolamine acid amidase inhibitor that suppresses inflammation and human macrophage activation. ACS Chem Biol 2015;10:1838–46.
- 62. Garrido-Trigo A, Corraliza AM, Veny M, et al. Macrophage and neutrophil heterogeneity at single-cell spatial resolution in human inflammatory bowel disease. Nat Commun 2023;14:4506.
- 63. Teng MW, Bowman EP, McElwee JJ, et al. IL-12 and IL-23 cytokines: from discovery to targeted therapies for immune-mediated inflammatory diseases. Nat Med 2015;21:719–29.
- 64. Jacobse J, Brown RE, Li J, et al. Interleukin-23 receptor signaling impairs the stability and function of colonic regulatory t cells. Cell Rep 2023;42:112128.
- 65. Parham C, Chirica M, Timans J, et al. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol 2002;168:5699–708.
- 66. Li Y, Zhao J, Yin Y, et al. The role of STAT3 signaling pathway activation in subconjunctival scar formation after glaucoma filtration surgery. Int J Mol Sci 2023;24:12210.
- 67. Bode JG, Ehlting C, Haussinger D. The macrophage response towards LPS and its control through the p38(MAPK)-STAT3 axis. Cell Signal 2012;24:1185–94.
- 68. Liang Z, Tang Z, Zhu C, et al. Intestinal CXCR6(+) ILC3s migrate to the kidney and exacerbate renal fibrosis via IL-23 receptor signaling enhanced by PD-1 expression. Immunity 2024;57:1306–23.e8.
- 69. Niess JH, Brand S, Gu X, et al. CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science 2005;307:254–8.
- 70. Bauche D, Joyce-Shaikh B, Jain R, et al. LAG3(+) regulatory T cells restrain interleukin-23-producing CX3CR1(+) gut-resident macrophages during group 3 innate lymphoid cell-driven colitis. Immunity 2018;49:342–52.e5.
- 71. Joeris T, Muller-Luda K, Agace WW, Mowat AM. Diversity and functions of intestinal mononuclear phagocytes. Mucosal Immunol 2017;10:845–64.
Associated Data
Supplementary Materials
Data Availability Statement
The data used to support the findings of this study are available from the corresponding author upon request.