Endocannabinoid system gene expression in mesocorticolimbic brain regions of individuals with alcohol use disorder: A descriptive study
ENDOCANNABINOID EXPRESSION IN ALCOHOL USE
García‐Gutiérrez et al.
Instituto de Neurociencias, Campus de San Juan Universidad Miguel Hernández‐CSIC Alicante Spain
Red de Investigación en Atención Primaria de Adicciones Instituto de Salud Carlos III, MICINN and FEDER Madrid Spain
Instituto de Investigación Sanitaria y Biomédica de Alicante (ISABIAL) Alicante Spain
Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12) Madrid Spain
Departamento de Psiquiatría, Facultad de Medicina Universidad Complutense de Madrid Madrid Spain
Servicio de Psiquiatría Hospital Universitario 12 de Octubre Madrid Spain
* CorrespondenceJorge Manzanares, Instituto de Neurociencias, Campus de San Juan, Universidad Miguel Hernández‐CSIC, Av. Ramón y Cajal s/n, San Juan de Alicante, Alicante, 03550, Spain.
Email: jmanzanares@umh.es
Abstract
Aims
To describe differences in the expression of genes encoding cannabinoid receptors (CNR1, CNR2), the associated receptor GRP55 and the enzymes fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MGLL) between individuals with alcohol use disorder (AUD) and controls in key mesocorticolimbic brain regions.
Design
Case‐control, observational postmortem study comparing gene expression in brain tissue from individuals diagnosed with AUD and matched controls. The study was not pre‐registered and should therefore be considered exploratory.
Setting
Brain collection from the New South Wales Tissue Resource Centre (NSWTRC) at the University of Sydney, Australia.
Participants/cases
Brain samples were obtained from 18 patients with AUD (mean alcohol use = 35.5 ± 8.7 drinking years) and 18 controls (C). Groups were matched for age (AUD: 55.8 ± 9; C: 56.3 ± 9.4) and postmortem interval (AUD: 39.7 ± 16.9 h; C: 31.8 ± 13.2 h).
Measurements
Relative gene expression of CNR1, CNR2, GPR55, FAAH and MGLL was quantified using real‐time polymerase chain reaction (qPCR) in the prefrontal cortex (PFC) and nucleus accumbens (NAc).
Findings
Compared with controls, individuals with AUD showed higher CNR1 in the PFC (+125%) and NAc (+78%) and lower CNR2 expression in both regions (PFC: −50%; NAc: −49%). GPR55 was higher in the PFC (+19%) and lower in the NAc (−51%). FAAH expression was lower in the PFC (−15%) and higher in the NAc (+24%), whereas MGLL expression did not differ in the PFC and was lower in the NAc (−15%).
Conclusions
This descriptive postmortem study identifying region‐specific differences in endocannabinoid system gene expression between individuals with alcohol use disorder (AUD) and controls supports an involvement of the endocannabinoid system in the neuropathological features associated with AUD, although causal relationships cannot be inferred.
Article notes
García‐Gutiérrez MS , Torregrosa AB , Navarrete F , Aracil‐Fernández A , Rubio G , Manzanares J . Endocannabinoid system gene expression in mesocorticolimbic brain regions of individuals with alcohol use disorder: A descriptive study. Addiction. 2026;121(5):1179–1189. 10.1111/add.70293 PMC1308892841424074
Footnote Group
INTRODUCTION
Alcohol use disorders (AUD) rank as the third leading cause of morbidity and mortality worldwide, causing over 3.3 million deaths each year [1]. As alcohol dependence advances, it often co‐occurs with psychiatric disorders, leading to significantly higher levels of disability, morbidity and mortality related to AUD. Despite these alarming figures, current treatment options for AUD are limited and have only modest success [2, 3]. The development of new and effective treatment options for AUD involves identifying the neurobiological mechanisms behind it, which, despite efforts, are still pending.
A growing and compelling body of evidence indicates that the endocannabinoid system (ECS) plays a significant role in AUD. This system comprises cannabinoid receptors of type 1 (CB1R) and type 2 (CB2R), their endogenous ligands and the enzymes that regulate their metabolism, primarily fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL). The CB1R (encoded by the CNR1 gene) is highly expressed in brain regions critical for reward and executive function, such as the nucleus accumbens (NAc) and the prefrontal cortex (PFC) [4, 5]. CB2R, encoded by the CNR2 gene, has also been identified in several brain regions, including those within the mesocorticolimbic system [6, 7, 8]. Both cannabinoid receptors have been identified as crucial targets that modulate dopaminergic signaling within the mesocorticolimbic pathway, and changes in these receptors have been observed in rodents with high ethanol vulnerability across several brain regions of this circuit [9, 10, 11, 12, 13]. In addition, genetic and pharmacological studies in rodents further support the involvement of CB1R and CB2R in regulating ethanol intake, tolerance, dependence and relapse vulnerability [7, 14, 15, 16].
Additionally, changes in FAAH and MAGL expression in rodent brain regions during ethanol intake and withdrawal have been documented in several studies. Pharmacological inhibition of FAAH significantly reduced voluntary alcohol intake and attenuated anxiety‐like behaviors during ethanol withdrawal [17, 18, 19, 20]. Similarly, inhibition of MAGL, which increases 2‐arachidonoylglycerol (2‐AG) levels, reduces stress‐induced alcohol seeking and alcohol‐induced neuroinflammation [21, 22].
Recently, the G protein‐coupled receptor 55 (GPR55), a new member of the extended ECS [23] involved in regulating energy balance, obesity, diabetes, neuropathic pain, inflammation and cancer [24, 25, 26], has gathered attention for its potential involvement in neuroinflammation and reward‐related processes. Yet, its role in AUD remains largely unexplored. A previous study found increased gene expression in the amygdala of rats exposed to continuous or intermittent ethanol intake [27].
In humans, few studies have evaluated components of the ECS in AUD using imaging techniques and post‐mortem brain tissue analysis. Positron emission tomography (PET) studies examined whether alcohol dependence modified the availability of CB1R, with opposite results. Neumeister et al. [28], in a small sample of alcohol‐dependent males, found increased CB1R availability, whereas subsequent studies with large samples found reduced CB1R availability that persisted after a month of abstinence [29, 30]. Post‐mortem brain studies have also described a significant reduction of CB1R protein and functionality in the ventral striatum of chronic AUD patients [31]. Interestingly, CB1R protein and lower MAGL activity have been found in the PFC of individuals with AUD [32]. Moreover, an increase in CNR2 and GPR55 expressions was found in monocyte‐derived dendritic cells from individuals who consume alcohol [33]. Interestingly, acute alcohol administration in healthy volunteers increased the global brain availability of CB1R [29]. PET studies investigating FAAH have further supported alterations in ECS signaling in AUD, showing changes in FAAH availability across brain regions [34, 35]. Together, these findings highlight the complexity of ECS regulation in AUD and underscore the need for studies analyzing the expression of its main components in human post‐mortem brain tissue to improve understanding of their potential involvement in AUD.
This study aims to fill this gap by examining gene expression of key components of the ECS—CNR1, CNR2, FAAH, MGLL and GPR55—in the PFC and NAc of AUD patients who uniquely presented alcohol dependence. These samples were kindly provided by the New South Wales Tissue Resource Centre (NSWTRC) at the University of Sydney, Australia, with no other drug use disorders present. Using these unique human post‐mortem samples enables the characterization of gene expression differences in individuals with long‐term AUD and controls (C), with patients averaging approximately 35 years of drinking (±8.7 years). By focusing on human brain tissue, this work provides region‐specific information on molecular characteristics observed in individuals with chronic alcohol use and highlights potential targets for future research.
METHODS
Human samples
Post‐mortem frozen brain samples from patients with AUD (n = 18) and their respective C (n = 18) were obtained from The NSWTRC at the University of Sydney (Australia). This country has a large number of alcoholics who do not co‐abuse other drugs. This makes the alcoholic population of Australia a unique resource for researchers studying alcohol’s long‐term effects on the brain.
Patients met the criteria established in the Diagnostic and Statistical Manual for Mental Disorders, fourth edition (DSM‐IV) for AUD (mean age of beginning drinking: 20.3 ± 4.6; years of consumption: 35.5 ± 8.7) and did not suffer from any infectious disorder such as hepatitis B and C, HIV and AIDS and Creutzfeldt‐Jakob disease. Details on the methods used at the NSWBTRC to collect demographic, alcohol‐related and other behavioral data have been previously reported [36].
Demographic and post‐mortem data of all the subjects included in the present study are shown in Table 1. The PFC (Brodmann’s area 9) and NAc from AUD and C were used in this study. All individuals were Caucasian males and were matched as closely as possible for age (AUD: 55.8 ± 9; C: 56.3 ± 9.4), post‐mortem interval (AUD: 39.7 ± 16.9 hours; C: 31.8 ± 13.2 hours) and pH (AUD: 6.6 ±0.2, C: 6.7±0.2).
| Subject | Age, years | PMI (hours) | Brain pH | Began drinking | Drinking, years | COD category | Clinical history |
|---|---|---|---|---|---|---|---|
| AUD1 | 67 | 48 | 6.40 | 25 | 42 | Respiratory/toxicity | None |
| AUD2 | 41 | 54 | 6.70 | 25 | 16 | Neurological | None |
| AUD3 | 64 | 39 | 6.76 | 25 | 39 | Toxicity | Depression |
| AUD4 | 45 | 18.5 | 6.57 | 14 | 31 | Respiratory | Depression |
| AUD5 | 65 | 7 | 6.47 | 25 | 40 | Stroke | Depression |
| AUD6 | 61 | 59 | 6.57 | 16 | 45 | Cardiac | Depression |
| AUD7 | 49 | 44 | 6.41 | 16 | 33 | Cardiac | None |
| AUD8 | 49 | 16 | 6.19 | 14 | 35 | Cardiac | None |
| AUD9 | 62 | 40 | 6.59 | 25 | 37 | Cardiac | Depression |
| AUD10 | 44 | 59 | 6.87 | 18 | 26 | Cardiac | Depression |
| AUD11 | 60 | 28 | 6.48 | 17 | 43 | Infection | None |
| AUD12 | 50 | 34.5 | 6.93 | 16 | 34 | Respiratory/toxicity | Depression |
| AUD13 | 70 | 62 | 6.82 | 25 | 45 | Cardiac | Depression |
| AUD14 | 43 | 29 | 6.29 | 25 | 18 | Hepatic/blood loss | None |
| AUD15 | 58 | 21.5 | 6.65 | 20 | 38 | Infection | None |
| AUD16 | 55 | 17 | 6.85 | 25 | 30 | Respiratory | Depression |
| AUD17 | 58 | 44.5 | 6.47 | 15 | 43 | Cardiac | None |
| AUD18 | 63 | 28 | 6.89 | 19 | 44 | Respiratory | None |
| C1 | 50 | 30 | 6.37 | – | – | Cardiac | None |
| C2 | 59 | 40 | 6.53 | – | – | Cardiac | None |
| C3 | 55 | 12 | 6.38 | – | – | Cardiac | None |
| C4 | 50 | 40 | 6.87 | – | – | Cardiac | None |
| C5 | 69 | 52 | 6.95 | – | – | Cardiac | None |
| C6 | 67 | 25 | 6.70 | – | – | Cardiac | None |
| C7 | 48 | 17 | 6.62 | – | – | Cardiac | None |
| C8 | 59 | 28 | 6.77 | – | – | Cardiac | None |
| C9 | 64 | 41 | 6.73 | – | – | Cardiac | None |
| C10 | 47 | 27 | 6.66 | – | – | Cardiac | None |
| C11 | 61 | 22 | 6.41 | – | – | Cardiac | None |
| C12 | 61 | 30 | 6.69 | – | – | Cardiac | None |
| C13 | 66 | 32 | 6.66 | – | – | Cardiac | None |
| C14 | 53 | 26 | 6.36 | – | – | Cardiac | None |
| C15 | 66 | 63 | 6.91 | – | – | Cardiac | None |
| C16 | 62 | 46 | 6.95 | – | – | Cardiac | None |
| C17 | 37 | 14.5 | 6.46 | – | – | Cardiac | None |
| C18 | 40 | 27 | 6.79 | – | – | Cardiac | None |
RNA integrity number evaluation
Assessment of RNA quality is essential for obtaining reliable gene expression results through real‐time quantitative polymerase chain reaction (qPCR) analysis [37]. Total RNA was isolated from PFC and NAc snap‐frozen tissue using TRI Reagent (Applied Biosystems). The integrity of the RNA samples was examined using the 2100 Bioanalyzer (Agilent Technologies), which detects ribosomal RNA bands (18S and 28S). Based on the 28S/18S ratio, we calculated a value between 1 and 10, known as the RNA integrity number (RIN), as a measure of RNA degradation (with lower values indicating greater degradation). The electropherogram and gel images, representative of the RNA integrity from PFC and NAc, are shown in Figure 1. All RNA samples from C and AUD subjects had a mean RIN value of approximately 7 (PFC ==>C: 6.85 ± 0.105; AUD: 6.905 ± 0.125; NAc ==>C: 6.876 ± 0.079; AUD: 6.829 ± 0.105), indicating good quality RNA suitable for gene expression analyses [38].
qPCR analysis of CNR1, CNR2, GPR55, FAAH and MGLL
Relative gene expression analyses of CNR1, CNR2, GPR55, FAAH and MGLL in the PFC and NAc were performed in AUD and C. Briefly, total RNA was extracted from brain sections using Tri Reagent (Applied Biosystems). After DNAse digestion, reverse transcription was carried out according to the manufacturer’s instructions (Applied Biosystems). The relative expression of CNR1, CNR2, GPR55, FAAH and MGLL was quantified using TaqMan gene expression assays (CNR1: Hs00275634_m1; CNR2: a isoform primer pair and probe as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT; reverse, GCTGGCCTTGGAGAGTGACA; MGB Taqman probe, CCAGATGCAGCCGC; GPR55: Hs00271662_s1; FAAH: Hs01038664_m1; MGLL: Hs00996004_m1) with a fluorescent dye specific for double‐stranded DNA, performed on the StepOne Sequence Detector System (Applied Biosystems). In this study, two housekeeping genes, cyclophilin (PPIA, Hs99999904_m1) and synaptophysin (SYP, Hs00300531_m1), were used to ensure the accuracy and reproducibility of the results. All reagents were sourced from Applied Biosystems, and manufacturer protocols were strictly followed. Primer‐probe sets were optimized and validated for relative quantification of gene expression. Data for each target gene were normalized to the endogenous reference genes, and fold change was calculated using the 2−ΔΔCt method [39]. The results for each sample are expressed as the mean value obtained with each endogenous housekeeping gene (PPIA and SYP).
Statistical analyses
Normality of numeric variables was assessed using the Shapiro–Wilk test (given the sample size of fewer than 50 patients), and homogeneity of variances was assessed using Levene’s test based on the median.
For normally distributed variables, results are presented as mean ± SD, and comparisons between groups were performed using the Student’s t test. For non‐normally distributed variables, data were analyzed using the Mann‐Whitney U test. However, for visual consistency across panels, all figures display data as mean ± SD.
Spearman’s rank correlation coefficient was applied to analyze potential correlations between age, post‐mortem interval (PMI), brain pH, RIN, the age of onset of alcohol consumption and the number of drinking years, on the one hand, and gene expression results, on the other.
All statistical analyses were conducted using R (version 4.5.0), using the following packages: dplyr (1.1.4), readr (2.1.5), tidyr (1.3.1), gtsummary (2.3.0), ggplot2 (3.5.2) and ggpubr (0.6.1). SigmaPlot 11 software (Systat Software) was used to create figures. A P‐value < 0.05 was considered statistically significant.
Differences in the number of samples processed among brain regions and genes reflect variability in the amount of human tissue available for each assay. All available data were included in the analyses, and no data were missing.
The study adheres to the STROBE guidelines for reporting observational research (see Table S1).
RESULTS
All data were tested for normality and homogeneity of variances before statistical analyses; detailed results of these assumption tests are reported in Table S2.
CNR1 expression differences in PFC and NAc between AUD and C subjects
Analyses of the relative CNR1 gene expression revealed higher levels in the PFC [Figure 2(a)] (Mann‐Whitney U = 12, P < 0.001) (AUD = 16; C = 13) and NAc [Figure 2(b)] (Mann‐Whitney U = 12, P < 0.001) (AUD = 16; C = 11) of AUD compared with C.
CNR2 A isoform expression differences in PFC and NAc between AUD and C subjects
GPR55 expression differences in PFC and NAc between AUD and C subjects
Higher levels of GPR55 were observed in the PFC of AUD compared to C subjects ([Figure 2(e)] Student t test: t = −3.763, P < 0.001, 25 d.f.) (AUD = 15; C = 13). In contrast, lower levels were found in the AUD group compared with the C subjects in the NAc [Figure 2(f)] (Student t test: t = 3.662, P = 0.001, 28 d.f.) (AUD = 16; C = 14).
FAAH expression differences in PFC and NAc between AUD and C subjects
FAAH expression was found to be lower in the PFC of AUD subjects compared to C subjects [Figure 3(a)] (Mann‐Whitney U = 64, P = 0.046) (AUD = 15; C = 15). In contrast, in the NAc, higher levels were found in the AUD group compared to C subjects [Figure 3(b)] (Student t test: t = −2.466, P = 0.019, 32 d.f.) (AUD = 16; C = 18).
MGLL expression differences in PFC and NAc between AUD and C subjects
There were no differences observed in MGLL expression in the PFC between AUD and C [Figure 3(c)] (Student t test: t = −0.189, P = 0.852, 28 d.f.) (AUD = 15; C = 15). Interestingly, in the NAc, significantly lower levels were found in the AUD group compared to C subjects ([Figure 3(d)] Student t test: t = 2.190, P = 0.036, 32 d.f.) (AUD = 16; C = 18).
Spearman product–moment correlation analyses revealed a significant correlation between brain pH and CNR1 (r = 0.52, P = 0.03) and GPR55 (r = −0.61, P = 0.02) in the PFC. Moreover, a significant correlation was found between age of drinking onset and CNR2 in the NAc (r = −0.5, P = 0.04). No other significant correlations were detected (Table 2 and Figure S1).
| Group | Gene expression/region | Age, years | PMI | pH | RIN PFC | RIN NAc | Began drinking | Drinking years |
|---|---|---|---|---|---|---|---|---|
| Controls | CNR1/PFC | r = −0.28 P = 0.36 | r = −0.43 P = 0.14 | r = −0.25 P = 0.41 | r = −0.71 P = 0.01 | – | – | – |
| CNR1/NAc | r = 0.39 P = 0.24 | r = 0.35 P = 0.3 | r = 0.07 P = 0.83 | – | r = −0.06 P = 0.85 | – | – | |
| CNR2/PFC | r = 0.37 P = 0.21 | r = 0.27 P = 0.37 | r = 0.16 P = 0.6 | r = 0.01 P = 0.99 | – | – | – | |
| CNR2/NAc | r = −0.08 P = 0.78 | r = −0.07 P = 0.81 | r = −0.1 P = 0.71 | – | r = −0.24 P = 0.39 | – | – | |
| GPR55/PFC | r = 0.03 P = 0.92 | r = −0.03 P = 0.92 | r = 0.14 P = 0.66 | r = 0.29 P = 0.36 | – | – | ||
| GPR55/NAc | r = −0.03 P = 0.91 | r = 0.39 P = 0.17 | r = 0.11 P = 0.71 | r = −0.08 P = 0.79 | – | – | ||
| FAAH/PFC | r = 0.24 P = 0.39 | r = 0.01 P = 0.96 | r = 0.14 P = 0.62 | r = 0.19 P = 0.5 | – | – | ||
| FAAH/NAc | r = −0.13 P = 0.6 | r = 0.11 P = 0.66 | r = 0.19 P = 0.44 | r = −0.11 P = 0.65 | – | – | ||
| MGLL/PFC | r = 0.06 P = 0.84 | r = 0.26 P = 0.35 | r = 0.35 P = 0.2 | r = 0.23 P = 0.40 | – | – | ||
| MGLL/NAc | r = −0.03 P = 0.9 | r = 0.15 P = 0.55 | r = −0.07 P = 0.77 | r = 0.23 P = 0.35 | – | – | ||
| AUD | CNR1/PFC | r = −0.19 P = 0.47 | r = 0.01 P = 0.95 | r = 0.52* P = 0.03 | r = 0.04 P = 0.88 | – | r = −0.03 P = 0.91 | r = −0.25 P = 0.33 |
| CNR1/NAc | r = 0.08 P = 0.75 | r = −0.05 P = 0.83 | r = 0.37 P = 0.13 | – | r = −0.04 P = 0.88 | r = 0.03 P = 0.91 | r = −0.003 P = 0.99 | |
| CNR2/PFC | r = −0.12 P = 0.67 | r = −0.06 P = 0.82 | r = 0.03 P = 0.92 | r = −0.25 P = 0.37 | – | r = −0.32 P = 0.25 | r = −0.04 P = 0.89 | |
| CNR2/NAc | r = −0.07 P = 0.79 | r = −0.15 P = 0.59 | r = 0.004 P = 0.99 | – | r = 0.33 P = 0.21 | r = −0.50* P = 0.04 | r = 0.003 P = 0.99 | |
| GPR55/PFC | r = −0.07 P = 0.81 | r = 0.03 P = 0.91 | r = −0.61* P = 0.02 | r = −0.07 P = 0.79 | ‐ | r = −0.09 P = 0.75 | r = 0.06 P = 0.82 | |
| GPR55/NAc | r = 0.14 P = 0.59 | r = −0.27 P = 0.27 | r = 0.19 P = 0.48 | – | r = 0.15 P = 0.59 | r = −0.16 P = 0.55 | r = 0.3 P = 0.26 | |
| FAAH/PFC | r = −0.19 P = 0.49 | r = −0.13 P = 0.63 | r = 0 P = 1 | r = −0.16 P = 0.56 | – | r = −0.13 P = 0.65 | r = −0.11 P = 0.69 | |
| FAAH/NAc | r = −0.09 P = 0.75 | r = 0.41 P = 0.11 | r = −0.04 P = 0.87 | – | r = −0.47 P = 0.07 | r = −0.23 P = 0.38 | r = 0.06 P = 0.81 | |
| MGLL/PFC | r = −0.46 P = 0.08 | r = −0.08 P = 0.78 | r = −0.38 P = 0.16 | r = 0.23 P = 0.41 | – | r = −0.3 P = 0.28 | r = −0.26 P = 0.36 | |
| MGLL/NAc | r = 0.16 P = 0.55 | r = 0.19 P = 0.48 | r = −0.49 P = 0.06 | – | r = 0.34 P = 0.19 | r = −0.23 P = 0.4 | r = 0.38 P = 0.14 |
DISCUSSION
The present study describes region‐specific differences in the expression of key elements within the ECS between individuals with AUD and C. These differences were observed in two brain regions within the mesocorticolimbic circuit, the PFC and NAc: (1) compared to C, individuals with AUD showed higher CNR1 and lower CNR2 expression in the PFC and NAc; (2) GPR55 expression was higher in the PFC but lower in the NAc; and (3) FAAH expression was lower in the PFC and higher in the NAc, whereas MGLL expression was lower in the NAc, with no group differences observed in the PFC.
These results are highly innovative for two main reasons. First, the samples analyzed are unique, AUD patients with a long history of alcohol consumption (35.5 ± 8.7 years) and no misuse of other addictive drugs. These samples enable the assessment of potential molecular differences associated with chronic alcohol use. Second, to our knowledge, this is the first study to simultaneously measure gene expression of cannabinoid receptors (CNR1, CNR2), the extended ECS receptor GPR55 and the enzymes FAAH and MGLL in brain regions of the mesocorticolimbic system in AUD patients. The study focused on the PFC and NAc, which are brain regions that play a crucial role in different aspects of alcohol addiction. The NAc is closely involved in reward, conditioning and habit formation [40, 41]. Dysfunctions of the PFC were related to the development of physical and social consequences induced by craving and compulsive drug‐seeking [42]. This may help identify whether differences in these targets are associated with chronic alcohol use.
Our results showed higher levels of CNR1 expression in the PFC and NAc of AUD patients compared with C. These findings generally match post‐mortem human studies on AUD. An increase in CB1R protein was observed in the PFC of AUD patients, whereas no changes in mRNA levels were detected [32]. Additionally, enhanced CB1R‐mediated G‐protein signaling has been previously detected in the PFC of alcoholic suicide victims [43]. Therefore, our results support earlier reports suggesting that chronic alcohol use may be associated with elevated CNR1 expression and signaling in cortical and limbic regions. Such alterations could influence dopaminergic signaling [29, 44] and synaptic plasticity, mechanisms that have been involved in alcohol reinforcement and relapse [4, 45].
However, our findings differ from PET studies reporting reduced CB1R availability in the brains of individuals with AUD [29, 30]. This discrepancy may reflect methodological differences between post‐mortem molecular analyses, which measure gene expression, and PET imaging, which assesses receptor binding and availability. Other factors, such as duration of abstinence before death or scanning, receptor internalization or post‐transcriptional regulation, could also contribute to these differences.
Conversely, lower levels of CNR2 expression were found in the PFC and NAc of individuals with AUD compared to C. These results are in agreement with previous studies of our lab that reported increased vulnerability to alcohol consumption in mice deficient in CB2R [7]. Moreover, CB2R mediates neuroprotective and anti‐inflammatory processes that may be impaired in AUD [46, 47, 48]. Therefore, the lower CNR2 expression identified in this study may reflect impaired regulatory mechanisms involved in neuroinflammation and neuronal integrity in individuals with chronic alcohol consumption [49, 50].
The fact that both cannabinoid receptor expressions differed in opposite directions between individuals with AUD and C may indicate a potential cooperation/interaction between them, as supported in previous studies. In animal models, a downregulation of CB2R and CB1R has been reported in the amygdala [51] and striatum [52, 53] following repeated ethanol withdrawal. Moreover, pharmacological blockade of CB2R has been shown to modify the Cnr1 expression in the NAc of mice exposed to ethanol self‐administration [54].
Interestingly, significant differences in GPR55 were also found, with higher levels in the PFC and lower levels in the NAc of AUD compared to C. Although there are no direct post‐mortem data on GPR55 expression in AUD brains, peripheral and in vitro studies suggest that ethanol induces GPR55 upregulation via an epigenetic mechanism [33]. Our finding of higher GPR55 expression in the PFC and lower in the NAc suggests a region‐specific role for this orphan G‐protein‐coupled receptor, a possibility warranting further investigation in human post‐mortem tissue.
This study confirms previous research that highlights the close interaction between cannabinoid receptors and GPR55. It has been demonstrated that CB1R and CB2R form heteromers in the rat striatum and that activated microglia exhibit bidirectional cross‐antagonism, negative cross‐talk in resting microglia and positive cross‐talk in activated microglia. Additionally, CB1R‐CB2R heteromers appear to help reduce neurotoxicity and neuroinflammation caused by psychostimulants [55, 56]. Recent studies also show that CB1R and GPR55 form heteromers in the striatum and human embryonic kidney (HEK293) cells, affecting their function [57]. Moreover, CB2R and GPR55 collaborate to regulate the immune response [24, 58] and play key roles in suicide behavior [59]. Additionally, modulating GPR55, CB1R and CB2R is partly linked to lowering alcohol intake, vulnerability and relapse caused by cannabidiol (CBD) in mice [60]. Although further research is necessary to clarify the molecular mechanisms involved, it is plausible that cannabinoid receptors and GPR55 jointly influence pathways underlying alcohol dependence.
Furthermore, we found lower FAAH expression in the PFC and higher expression in the NAc, whereas MGLL expression did not differ in the PFC, but was lower in the NAc. These region‐specific differences may reflect alterations in ECS signaling, affecting the availability of anandamide (AEA) and 2‐AG, which are critical for synaptic function and plasticity [22, 61]. Previous studies have linked associations between differences in FAAH and MGLL expression and behavioral domains such as anxiety, stress response and addictive behaviors, all relevant to the pathophysiology of AUD [4, 62]. However, the results on FAAH expression in human post‐mortem studies are inconsistent or understudied. Erdozain et al. [32] reported no consistent bidirectional change in FAAH protein levels in the PFC, although downstream functional markers were altered. In line with our findings, PET imaging studies have shown lower FAAH availability in the brains of heavy‐drinking young adults and in individuals during early abstinence [34, 35]. Together, these findings suggest that alterations in FAAH may potentially influence emotional and reward‐related processes to alcohol. Our results provide evidence of region‐specific differences in FAAH and MGLL expression that have not been previously described in human post‐mortem tissue.
Additionally, exploratory Spearman’s correlations revealed significant associations within the AUD group. Brain pH correlated positively with CNR1 and negatively with GRP55 expression in the PFC. However, no significant correlations were observed in the C group, and mean brain pH values were comparable between groups (AUD: 6.6 ± 0.2; C: 6.7 ± 0.2). Importantly, no significant correlations were found between gene expression levels and the RIN or PMI. These findings suggest that differences in gene expression are unlikely because of sample degradation or other post‐mortem factors.
Furthermore, CNR2 expression in the NAc was inversely associated with the age of drinking onset, suggesting that earlier initiation of alcohol use may be linked to lower CNR2 expression levels in this brain region. These correlations should be interpreted with caution, given the modest sample size and the exploratory nature of the analysis. Still, they may provide insights into the relationship between clinical variables and ECS‐related gene expression in AUD. Conversely, correlations that did not reach statistical significance should be interpreted as a lack of statistical evidence for association, rather than evidence of the absence of a relationship.
In summary, this descriptive post‐mortem study reveals region‐specific differences in ECS gene expression between individuals with AUD and C. These molecular differences may reflect alterations in ECS‐related pathways associated with AUD and contribute to a better understanding of its neurobiological mechanisms. However, causal relationships cannot be inferred from these observational data.
One limitation of the study is that several individuals in the AUD group presented co‐morbid depression, whereas none of the C cases did. Because depression is also linked to the ECS, this comorbidity may have influenced the findings and should be addressed in future studies with depression‐matched C groups. Another limitation of this study is the relatively small sample size and the inclusion of only male subjects, which may limit the applicability of the findings to broader populations. Only two brain regions were analyzed because of tissue availability. Future studies should include additional areas, such as the ventral tegmental area, to provide a more comprehensive understanding of ECS alterations in AUD.
DECLARATION OF INTERESTS
None.
Supporting information
ACKNOWLEDGEMENTS
Tissues were received from the New South Wales Brain Tissue Resource Centre at the University of Sydney, which the University of Sydney supports. Research reported in this publication was supported by the National Institute of Alcohol Abuse and Alcoholism of the National Institutes of Health under award number R28AA012725. The content is solely the responsibility of the authors and does not represent the official views of the National Institutes of Health. We thank the Bioinformatics Service of the Instituto de Investigación Sanitaria y Biomédica de Alicante, Alicante, Spain, for providing statistical support.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the corresponding author upon reasonable request.