Activating GPR55 protects cochlear hair cells against cisplatin-induced ototoxicity via inhibiting MAPK pathway
https://ror.org/047aw1y82grid.452696.aDepartment of Otolaryngology-Head and Neck Surgery, The Second Affiliated Hospital of Anhui Medical University, Hefei, 230601 China
Abstract
Cisplatin (CDDP) is an effective chemotherapeutic agent used to treat solid tumors, but it can cause irreversible hearing loss. Currently, there are no specific preventive measures available for this side effect. G protein-coupled receptor 55 (GPR55) exhibits antioxidant, anti-inflammatory, and anti-apoptotic properties and is implicated in various disease processes. Nevertheless, whether GPR55 plays a role in CDDP-induced hearing loss remains unclear. We explored the effects and mechanisms of O-1602, a GPR55 agonist, on CDDP-induced ototoxicity. Our results showed that GPR55 is present in cochlear hair cells and HEI-OC1 cells, with increased expression following CDDP exposure. Moreover, O-1602-induced activation of GPR55 markedly mitigated the ototoxic effects of CDDP in HEI-OC1 cells, cochlear explants, and mouse models by preventing oxidative stress and apoptosis. In addition, GPR55 protected against CDDP-induced damage via inhibiting the MAPK pathway. Therefore, GPR55 is a potential therapeutic target for preventing CDDP-induced ototoxicity.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-026-48548-6.
Introduction
Hearing impairment affects approximately 5% of the global population and represents a serious global health concern1. Many factors contribute to auditory impairment, such as aging, genetic predisposition, excessive noise exposure, and exposure to ototoxic chemicals2–4. Cisplatin (CDDP) is a chemotherapeutic drug commonly used for the treatment of solid tumors and is known to be ototoxic5,6. CDDP-induced ototoxicity affects various structures and cell types within the cochlea, with hair cells (HCs) being particularly vulnerable7. A key mechanism underlying CDDP-related ototoxicity is the overaccumulation of reactive oxygen species (ROS) in HCs, which activates apoptotic cascades that cause cell death8–10. Sodium thiosulfate has recently received FDA approval specifically for preventing hearing loss in pediatric patients treated with CDDP. However, significant clinical needs remain unmet concerning its use in adult patients and other specific populations or clinical scenarios. Therefore, novel therapeutic targets must be identified, and innovative pharmacological interventions should be developed to mitigate CDDP-related hearing loss.
G protein-coupled receptors (GPCRs) are widely distributed and play crucial roles in nearly all biological functions. They represent one of the largest classes of drug targets, accounting for 36% of all authorized medications that target these receptors11. Over 50 GPCRs have been identified within the inner ear, where they play roles in determining cell fate, promoting cell survival, and protecting HCs from ototoxic stress-induced damage12,13. For example, Adenosine A1 receptor (A1AR) activation protects the cochlea from CDDP-induced hearing loss via inhibiting oxidative stress and inflammatory pathways14. Additionally, A1AR protects against age-related and noise-induced hearing loss15,16. Cannabinoid receptor 2 (CB2R) is present in spiral vessels, spiral ganglion neurons, and HCs in the inner ear, and its expression increases following CDDP administration17,18. Moreover, CB2R activation can alleviate HC injury, prevent ribbon synapse degeneration, and mitigate hearing loss caused by CDDP17,19. Consequently, GPCRs are candidates for mitigating the ototoxic effects associated with CDDP exposure.
G protein-coupled receptor 55 (GPR55) is a nonclassical cannabinoid receptor with a strong binding affinity for various endogenous and synthetic cannabinoids, such as cannabidiol, anandamide, and O-160220–22. L-α-lysophosphatidylinositol is a bioactive lipid that also activates GPR5523,24. Additionally, GPR55 is a key target of curcumin and contributes to its physiological effects25.
GPR55 is widely distributed across various organs and tissues, playing a vital role in numerous physiological processes26. It is also involved in several pathological conditions. Notably, GPR55 is a receptor located in brain regions associated with depression, with its levels significantly reduced in the medial orbitofrontal cortex of individuals exhibiting anxiety-like behaviors compared to healthy controls. Furthermore, activation of GPR55 with O-1602 reduces depression-associated symptoms27. L-α-lysophosphatidylinositol demonstrates neuroprotective effects following injury by activating the GPR55 pathway to mitigate cellular inflammation and oxidative stress28,29. Moreover, O-1602 mitigates cognitive impairments and neurotoxicity in Alzheimer’s disease models, indicating that GPR55 is a promising therapeutic target for this condition30. These results highlight the importance of GPR55 in preserving physiological functions and its potential as a therapeutic target for various disorders.
The function of GPR55 in sensorineural hearing loss remains unclear despite extensive research. This study revealed that GPR55 is localized in the HCs of the auditory system, with its expression levels increasing in response to CDDP-induced ototoxicity. Moreover, the functionality of HEI-OC1 cells and HCs, which was impaired by CDDP treatment, improved following pretreatment with O-1602, indicating a protective role for GPR55. Thus, GPR55 represents a potential therapeutic target for combating the ototoxic effects of CDDP exposure.
Materials and methods
Compounds
CDDP (MCE, HY-17394) was dissolved in N, N-Dimethylformamide (DMF). O-1602 and ML-193, purchased from MCE (HY-107541 and HY-110125, respectively), were dissolved in dimethyl sulfoxide (DMSO) at their respective storage concentrations. These compounds were diluted to the appropriate concentrations in tissue culture medium or high-glucose Dulbecco’s Modified Eagle Medium (DMEM) for treating tissues or cells.
Cell culture
HEI-OC1 cells, purchased from Cyagen (Guangzhou, China), were grown in DMEM supplemented with 10% fetal bovine serum to provide suitable growth conditions. The cells were maintained at 33 °C in a humidified environment containing 5% CO2. A solution of 0.25% trypsin with EDTA was used to detach the cells from the surface.
Mouse model
We used six-week-old male C57BL/6 mice, which were obtained from GemPharmatech (Nanjing, China), to develop an in vivo model of CDDP-induced sensorineural hearing loss. All experiments involving animals were performed in accordance with the directives established by the Hefei Comprehensive National Science Center’s Health Experimental Animal Welfare and Ethics Committee with the approval number IHM-AP-2024-032 and were conducted in strict adherence to the ARRIVE guidelines. All mice were housed under controlled environmental conditions, maintaining optimal humidity and temperature, with a 12-hour (h) light/dark cycle and access to ample water and food. After confirming normal hearing function through auditory brainstem response (ABR) testing, the mice were randomly grouped into several groups: a control group, a furosemide (FO) treatment group, an O-1602 treatment group, a CDDP treatment group, and a combined treatment group receiving both O-1602 and CDDP. The O-1602 group was given an injection of 5 mg/kg two hours beforehand, while the other groups were administered equivalent doses of DMSO. Two hours later, FO (200 mg/kg) was administered to promote CDDP-induced ototoxicity, followed by CDDP at 0.6 mg/kg after a 30-minute delay. Following drug administration, each mouse received a 500 µL injection of 0.9% saline to minimize discomfort and mortality throughout the procedure. All treatments were delivered via intraperitoneal injection to ensure the effective systemic absorption of the treatments. Hearing condition was assessed 7 days after administration. After the ABR test, the mice were humanely euthanized using CO2, and their cochleae were dissected for analysis of HCs and synapses.
Cochlear explant culture
The cochleae were carefully collected from mice on postnatal day 3 (P3). Surrounding tissue was removed in cold HBSS to ensure that the cochleae were clean and ready for further experimentation. The isolated cochlear explants were placed on sterilized glass coverslips precoated with Cell-Tak. These coverslips were placed in four-well plates to create the culture environment. The explants were then cultured in DMEM enriched with N2 and B27 (Gibco, 17502048 and 17504044, respectively). The entire culture setup was maintained at 37 °C in a 5% CO2 environment within a cell incubator for overnight incubation.
Cell viability
Cell viability was assessed using a Cell Counting Kit-8 (CCK-8; Beyotime, C0038). HEI-OC1 cells were plated in 96-well plates and allowed to incubate overnight before treatment. The original medium was removed from each well after treatment and substituted with 100 µL of DMEM containing 10 µL of CCK-8 reagent. The cells were then incubated for 2 h before being examined.
Protein extraction and Western blotting
Samples of cells or tissues were gathered and lysed using RIPA buffer containing 1% protease inhibitor cocktail. The extracted proteins were analyzed using polyacrylamide gel electrophoresis, for which equal amounts of protein were separated. The proteins were transferred onto polyvinylidene fluoride membranes after electrophoresis. The membranes were blocked at room temperature (RT) using 5% skim milk. We incubated the polyvinylidene fluoride membranes at 4 °C overnight. The primary antibodies utilized in this procedure are listed in Supplementary Table 1. The secondary antibodies were subsequently incubated with the membranes for 2 h at RT, and an ECL detection kit was used to detect the protein bands.
RNA extraction and qPCR
The cells were harvested after treatment, and the total RNA extraction was carried out using TRIzol reagent in accordance with the provided instructions. Complementary DNA (cDNA) was synthesized, and qPCR was conducted on a Bio-Rad CFX96 real-time PCR system with the primers listed as follows.
| Primer name | Primer sequences (Forward) | Primer sequences (Reverse) |
|---|---|---|
| Caspase-3 | ATGGAGAACAACAAAACCTCAGT | TTGCTCCCATGTATGGTCTTTAC |
| Caspase-8 | TGCTTGGACTACATCCCACAC | TGCAGTCTAGGAAGTTGACCA |
| Apaf-1 | AGTAATGGGTCCTAAGCATGTTG | GCGATTGGGAAAATCACGTAAAA |
| FADD | GCGCCGACACGATCTACTG | TTACCCGCTCACTCAGACTTC |
| Bcl-2 | ATGCCTTTGTGGAACTATATGGC | GGTATGCACCCAGAGTGATGC |
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Immunofluorescence staining
We used 4% paraformaldehyde to fix the cells and tissues at RT for 1 h. Permeabilization was performed by incubating the samples in 0.5% PBST for 30 min, followed by a blocking step using 10% donkey serum for one hour. The samples were then incubated overnight at 4 °C in the presence of primary antibodies (see Supplementary Table 1). Afterward, the cells or tissues were rinsed three times with PBS, each wash lasting for 5 min, and incubated with secondary antibodies at RT for 2 h. Finally, the samples were treated with DAKO and mounted on glass coverslips. Images were acquired using a fluorescence microscope (Carl Zeiss).
ROS detection
The levels of ROS in both HCs and HEI-OC1 cells were assessed using mtSOX Deep Red (Dojindo Laboratories, MT14). The samples were washed with PBS and subsequently incubated at 37 °C in prewarmed DMEM containing 10 µM mtSOX Deep Red, kept out of light. Afterward, the samples were washed three times with PBS for 5 min each. Fluorescent images were captured using a Carl Zeiss confocal fluorescence microscope.
ABR test
The mice were sedated with an intraperitoneal injection of pentobarbital sodium at a dose of 100 mg/kg and gently placed into a sound-insulated chamber. During anesthesia, the mice were positioned on a heating pad set to 37 °C to maintain their body temperature and minimize potential discomfort or mortality. A recording electrode was subcutaneously inserted at the midline of the cranial roof, while the reference electrode was positioned behind the ear. We used a TDT System III (Tucker-Davis Technologies, USA) to record all responses, using brief pure tones as stimuli. The ABR thresholds and wave I amplitudes of the mice were measured at 4, 8, 12, 16, 24, and 32 kHz.
RNA sequencing (RNA-seq)
The total RNA was extracted using TRIzol Reagent. The purity, concentration, and RNA integrity number of the isolated RNA samples were assessed to ensure their quality and suitability for further analysis. The cDNA library was sequenced using the Illumina HiSeq platform. The cDNA expression levels of all samples were compiled into an expression matrix, and differential expression was analyzed at the gene or transcript level to identify functional differences related to sample grouping using DESeq2^6^ software. Statistical significance was set at a P-value < 0.05 and a fold change in expression of 2 or above (|log2FC| ≥ 1).
Statistical analysis
Data analysis was conducted using GraphPad Prism, and the results were presented as the mean ± standard error of the mean (SEM). One-way ANOVA was employed to identify differences among groups, while a t-test was used to determine significant differences between groups. Statistical significance is indicated by asterisks as follows: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.
Results
CDDP increased GPR55 levels in HEI-OC1 cells and cochlear explants
We thoroughly explored the role of GPR55 in CDDP-induced ototoxicity. Initially, GPR55 expression was detected using Myosin7a as a marker for HCs. Our immunostaining results revealed that GPR55 was present in the HCs of the mouse cochlea (Fig. S1A). Additionally, we detected GPR55 protein expression in HEI-OC1 cells (Fig. S1B), further confirming the presence of GPR55 in auditory cells.
We then verified the protein levels of GPR55 following treatment of HEI-OC1 cells and cochlear explants with CDDP. We developed a CDDP-induced injury model in HEI-OC1 cells by exposing the cells to various concentrations of CDDP (0, 5, 10, 15, or 20 µM) for either 6 or 24 h. The CCK-8 assay showed that cell survival decreased in a dose-dependent manner after 24 h, with cell viability dropping to about 50% at 15 µM CDDP. However, no cell damage was observed after 6 h of treatment (Fig. 1A and B). Next, we measured GPR55 expression levels using Western blotting and immunostaining. Western blot analysis depicted that GPR55 protein levels increased after 24 h of exposure to 15 µM CDDP compared to the control, with no significant difference observed after 6 h of exposure (Fig. 1C and D). Immunostaining results supported these findings, showing that GPR55 protein levels were markedly elevated after 24 h of treatment with 15 µM CDDP (Fig. 1E and F).
We also investigated GPR55 levels in cultured cochlear explants to better understand its role in the cellular response to damage. The optimal concentration of CDDP for the injury model was determined by treating cochlear tissues harvested from P3 mice with 0, 50, 100, or 150 µM CDDP for 24 h. Treatment with 150 µM CDDP caused severe damage to HCs, as evidenced by a marked decrease in Myosin7a-positive cells across the basal, middle, and apical turns of the cochlea compared to the control group. In contrast, no HC injury was observed at 50 or 100 µM (Fig. S2A-D). Therefore, we chose 150 µM CDDP for subsequent experiments. Western blot analysis revealed a marked increase in GPR55 protein levels after 24 h of CDDP treatment, while no notable change was observed at 6 h (Fig. 1G and H). Overall, these results indicate that GPR55 expression is substantially upregulated in HEI-OC1 cells and cochlear explants following CDDP exposure, suggesting that GPR55 is involved in CDDP-induced hearing impairment.
GPR55 activation attenuated CDDP-induced apoptosis in HEI-OC1 cells
To investigate the specific function of GPR55, we utilized O-1602, a selective GPR55 activator21(Fig. 2A). We assessed the toxicity of O-1602 using a CCK-8 assay in HEI-OC1 cells. Cells were treated with O-1602 at concentrations of 0, 1, 2, 5, or 10 µM for 24 or 48 h. There was no significant change in cell viability across different concentrations or treatment durations, suggesting that O-1602 is not toxic to HEI-OC1 cells at concentrations up to 10 µM (Fig. 2B, C).
We then assessed the effect of O-1602 on ototoxicity induced by CDDP. HEI-OC1 cells underwent pretreatment with varying concentrations of O-1602 for 2 h, followed by co-incubation with 15 µM CDDP for 24 h. The CCK-8 assay revealed that cell viability was considerably lower in the group treated with 15 µM CDDP compared to the control group. However, cell viability was higher with O-1602 pretreatment than without, with 2 µM O-1602 providing the strongest protection against the toxic effects of CDDP (Fig. 2D). Therefore, we chose 2 µM O-1602 for use in subsequent experiments with HEI-OC1 cells.
We confirmed the protective function of GPR55 against CDDP-induced cellular damage by assessing apoptosis. Figure 2E and F demonstrate that the number of cleaved CASP3-positive cells was higher in the CDDP-treated group than in the control group, indicating that CDDP exposure triggered apoptosis in these cells. Pretreatment with O-1602 reduced the percentage of apoptotic cells compared to the group without pretreatment, highlighting the protective role of O-1602. Treatment with O-1602 alone did not adversely affect the HEI-OC1 cells. Western blot analysis further supported these findings, showing that O-1602 pretreatment diminished the levels of apoptosis-related proteins, cleaved CASP3 and BAX, compared to treatment with CDDP alone (Fig. 2G-I). Additionally, the qPCR results indicated that the expression levels of apoptosis-related and anti-apoptotic genes varied across different treatments. As shown in Fig. 2J, CDDP treatment increased the expression of apoptotic genes such as Caspase-3, Caspase-8, Apaf-1, and FADD compared to the control group. However, pretreatment with O-1602 considerably reduced the expression levels of Caspase-3, Apaf-1, and FADD. Although Caspase-8 expression tended to decrease in the O-1602 pretreatment group compared to the group without pretreatment, this reduction was not statistically significant. In contrast, Bcl-2 expression levels declined following CDDP treatment but increased after O-1602 pretreatment, further supporting the protective function of O-1602 against CDDP-induced apoptosis in HEI-OC1 cells.
GPR55 activation alleviated CDDP-induced oxidative stress in HEI-OC1 cells
The primary factor responsible for the ototoxic effects of CDDP is oxidative stress. Therefore, we assessed the effect of O-1602 on CDDP-induced oxidative stress in HEI-OC1 cells. We used the fluorescent probe mtSOX Deep Red to estimate mitochondrial superoxide levels. The fluorescence intensity of mtSOX Deep Red increased following exposure to CDDP. Importantly, this increase was markedly lower in cells pretreated with 2 µM O-1602 compared to cells treated with CDDP alone (Fig. 3A, B). Additionally, we measured the levels of 4-Hydroxynonenal (4-HNE) and 3-Nitrotyrosine (3-NT), which are indicators of oxidative stress, in HEI-OC1 cells to further validate our results31. Both 4-HNE and 3-NT expression levels increased following CDDP exposure but were reduced when the cells were pretreated with O-1602 (Fig. 3C-E). In general, activation of GPR55 with O-1602 diminishes CDDP-induced oxidative stress in HEI-OC1 cells.
We concurrently administered ML-193, a selective GPR55 antagonist32, along with O-1602 to validate the protective effects of O-1602 against CDDP-induced toxicity. We assessed the cytotoxicity of ML-193 on cells using a CCK-8 assay. ML-193 concentrations up to 20 µM were non-toxic to HEI-OC1 cells (Fig. S3A), confirming its safety for cellular applications. We then simultaneously treated HEI-OC1 cells with 10 µM ML-193 and 2 µM O-1602 following CDDP exposure. Subsequent Western blot analysis demonstrated that ML-193 treatment effectively abolished the protective effects of O-1602, as levels of cleaved CASP3 and 4-HNE did not reduce when both treatments were applied (Fig. S3B-D). Immunofluorescence analysis of cleaved CASP3 supported these findings (Fig. S3E, F), further validating our hypothesis that activation of GPR55 by O-1602 is essential for protecting HEI-OC1 cells from CDDP-induced ototoxicity.
Activating GPR55 protected against CDDP-induced HC loss in cochlear explants
We investigated the effect of GPR55 activation on HCs in cochlear explants. These explants were pretreated with either 2 or 5 µM of O-1602 for 2 h, followed by exposure to 150 µM CDDP for 24 h. Figure 4 presents the survival of HCs under different treatment conditions. The number of HCs in the basal, middle, and apical regions of the cochlea was largely lower after treatment compared to baseline. In contrast, pretreatment with either 2 or 5 µM O-1602 promoted HC survival (Fig. 4A–D). These results suggest that O-1602 may protect HCs by mitigating the harmful effects of CDDP treatment.
We further investigated the protective effects of O-1602 on HCs treated with CDDP. Cochlear explants were pretreated with 2 µM O-1602, with or without 10 µM ML-193, followed by exposure to 150 µM CDDP. The number of HCs in the group treated with O-1602, ML-193, and CDDP was lower compared to the group treated with O-1602 and CDDP. Administering 10 µM ML-193 alone did not cause damage to the HCs (Fig. S4A-D). These results imply that activation of GPR55 by O-1602 is important for protecting HCs from cell death in vitro.
GPR55 activation attenuated CDDP-induced apoptosis and oxidative stress in HCs within cochlear explants
We then explored the protective effects of GPR55 on HCs in cultured cochlear explants by performing co-staining with TUNEL and anti-Myosin7a to assess apoptosis levels. Figure 5A and B illustrate that the number of TUNEL-positive HCs was higher following CDDP treatment compared to the control group. In contrast, fewer apoptotic cells were observed in the group pretreated with O-1602. Moreover, administration of O-1602 alone did not considerably increase the levels of apoptosis compared to the control group. These results indicate that GPR55 contributes to reducing CDDP-induced apoptosis in HCs within cochlear explants.
The antioxidative properties of GPR55 were detected in HCs. Cochlear explants were co-stained with mtSOX Deep Red and Myosin7a antibody, and the double-stained cells were counted. The number of mtSOX Deep Red-positive HCs increased following CDDP treatment compared to baseline. However, this increase was less pronounced in samples pretreated with O-1602. Administration of O-1602 alone did not affect oxidative stress levels (Fig. 5C, D). Collectively, these findings suggest that GPR55 alleviates the oxidative stress caused by CDDP in the HCs of cochlear explants.
GPR55 mitigated CDDP-induced ototoxicity via inhibiting the MAPK pathway
We investigated the mechanisms by which O-1602 exerts protective effects using RNA-seq to identify transcriptome-wide alterations between the CDDP group and the O-1602 + CDDP group in HEI-OC1 cells. A total of 174 genes were differentially expressed between the two groups, with 83 genes upregulated and 91 genes downregulated (Fig. 6A; Supplementary Table 2). We assessed the functional implications of these genes through KEGG pathway analysis, which identified the top 20 pathways exhibiting the most significant differences between the groups. Notably, one of the top-ranked pathways was the MAPK pathway, which is strongly associated with oxidative stress and apoptosis (Fig. 6B). We clarified the function of O-1602 in modulating the MAPK signaling cascade by using Western blotting to evaluate the levels of key proteins involved in this pathway. Exposure to CDDP markedly increased the expression levels of phosphorylated P38 MAPK (p-P38), phosphorylated JNK (p-JNK), and phosphorylated ERK1/2 (p-ERK1/2). However, pretreatment with O-1602 reversed these phosphorylation increases. Furthermore, the total protein levels of P38 MAPK, JNK1, and ERK1/2 remained largely unchanged across the groups (Fig. 6C-K). These results suggest that GPR55 protects HCs from CDDP-induced damage primarily by modulating the MAPK signaling pathway.
Activating GPR55 mitigated CDDP-induced hearing loss in vivo
Given that the protective effects of GPR55 have been confirmed in vitro, we evaluated its protective effects against hearing impairment in vivo using a mouse model of CDDP-induced ototoxicity. CDDP was administered following established protocols, along with 200 mg/kg of FO to enhance the ototoxic effects (Fig. 7A). We selected 5 mg/kg of O-1602 as the effective dose based on previous research33. CDDP treatment led to considerable hearing loss, as evidenced by a marked increase in ABR thresholds at all tested frequencies compared to the control group. However, mice pretreated with O-1602 exhibited lower ABR thresholds than those without pretreatment, suggesting some degree of hearing recovery (Fig. 7B). Cochlear samples were collected for further analysis. Our results revealed considerable outer hair cell (OHC) loss in the middle and basal regions of the cochlea caused by CDDP, while the apical region exhibited minimal damage. Pretreatment with O-1602 increased the number of OHCs in the middle and basal turns (Fig. 7C, D). There was no effect on inner hair cells (IHCs) in any of the groups (Fig. 7C). These findings suggest that GPR55 protects against CDDP-induced hearing loss and HC damage in vivo. Considering the ototoxic properties of FO, a diuretic agent, we administered a single injection of 200 mg/kg of FO. The ABR results showed no significant difference in hearing thresholds between the FO-treated group and the control group (Fig. S5A). Additionally, immunofluorescence analysis demonstrated that the HCs remained intact and well-organized after a single FO injection, suggesting that administering 200 mg/kg of FO alone does not cause ototoxicity in this case (Fig. S5B).
In the cochlea, ribbon synapses establish connections between IHCs and the auditory nerve and are especially susceptible to the ototoxic effects of CDDP17. Our study investigating the effects of O-1602 on these synapses demonstrated a significant reduction in ribbon synapse density in the apical, middle, and basal regions of the cochlea in the CDDP-treated group. However, in the group pretreated with O-1602, there was a notable prevention of ribbon synapse degeneration caused by CDDP (Fig. 7E, F). Overall, the study indicates that O-1602 mitigates hearing loss, OHC damage, and ribbon synapse degeneration induced by CDDP in vivo.
Discussion
CDDP is a potent chemotherapeutic agent widely used to treat solid tumors. However, its application is limited by side effects on normal tissues, including nephrotoxicity, neurotoxicity, and ototoxicity, which negatively affect patients’ quality of life and limit the overall effectiveness of cancer treatment34–36. Approximately 40–60% of patients undergoing CDDP therapy experience progressive and irreversible hearing loss, highlighting the severity of this issue37. The damaging effects of CDDP are exacerbated by the overaccumulation of ROS, which compromises intracellular defense mechanisms and leads to permanent hearing loss9,38. Given the absence of a universally effective treatment to prevent CDDP-induced ototoxicity, we are motivated to explore novel targets for developing such therapies.
Activating certain GPCRs within the cochlea plays a crucial role in protecting against hearing impairment and HC loss12. GPR55, a member of the seven-transmembrane GPCR family involved in cannabinoid signaling39, and also exhibits antioxidant and anti-inflammatory properties26. This study reveals an increase in GPR55 expression levels following CDDP exposure in both HEI-OC1 cells and cultured cochlear explants. Pretreatment with O-1602 preserved the viability of HEI-OC1 cells and the survival of cochlear HCs after CDDP exposure in vitro. Moreover, intraperitoneal administration of O-1602 before CDDP notably reduced ABR thresholds and increased OHC and ribbon synapse survival. Collectively, these findings suggest that GPR55 could be a promising therapeutic target for mitigating the ototoxic effects of CDDP. Considering that another cannabinoid receptor, CB2R, also protects against CDDP-induced hearing loss17, we hypothesize that cannabinoid receptors may function as an innate defense system against such damage.
HC apoptosis is the primary mechanism responsible for CDDP-induced ototoxicity40. GPR55 has been shown to protect the hippocampus and frontal cortex in Alzheimer’s disease, as well as pancreatic β cells, by inhibiting apoptosis30,41. Our results reveal that apoptosis increased in HEI-OC1 cells and HCs following CDDP treatment, consistent with previous studies42,43. However, this increase was lessened when HEI-OC1 cells and HCs were pretreated with O-1602. Moreover, O-1602 effectively inhibited apoptosis through both intrinsic and extrinsic pathways, as evidenced by reductions in the mRNA levels of Caspase-3, Apaf-1, and FADD, along with an increase in Bcl-2 mRNA levels44. In cochlear explants in vitro, we observed apoptotic cells that did not co-label with HCs, suggesting the involvement of other cell types, such as supporting cells. This finding aligns with earlier reports that CDDP induces apoptosis in supporting cells45. Overall, GPR55 offers protection against CDDP-induced ototoxicity by suppressing apoptotic pathways.
Oxidative stress is linked to HC damage; the overproduction of ROS overwhelms the antioxidative defense system, leading to HC injury and subsequent hearing loss. Therefore, antioxidant compounds such as sodium thiosulfate and N-Acetylcysteine have been used to mitigate the ototoxic effects of CDDP46,47. In this study, we expanded research on the antioxidative properties of O-1602 in the context of CDDP-induced ototoxicity. The findings indicate that O-1602 effectively reduces CDDP-induced ROS accumulation and the expression of oxidative stress-related proteins. These findings imply that O-1602 could be a promising candidate for future studies aimed at protecting HCs from oxidative stress-induced damage.
O-1602 is a selective agonist for GPR55, showing strong affinity for this receptor but no affinity for CB1R or CB2R48. The ability of O-1602 to activate GPR55 has prompted studies exploring this pathway; however, other GPCRs may also act as alternative targets for O-160249,50. To pinpoint the specific mechanisms underlying O-1602’s effects, we used the selective antagonist ML-193 to inhibit GPR55 activation. Our findings indicate that the protective effects of O-1602 on HCs and HEI-OC1 cells were abolished when ML-193 and O-1602 were administered simultaneously. This finding supports the conclusion that O-1602’s protective role in HCs depends on GPR55.
The MAPK pathway is essential in the eukaryotic signaling network by regulating cellular processes such as differentiation, proliferation, and apoptosis51,52. This pathway comprises several key components, including P38 MAPK, JNK, ERK1/2, and ERK5, each activated by different stimuli52,53. MAPK signaling has been reported to be associated with hearing loss54. Multiple studies indicate that activation of the MAPK signaling pathway, particularly P38 MAPK, JNK, and ERK1/2, may be a primary mechanism underlying CDDP-induced hearing damage45,55,56. Consequently, blocking the activation of these pathways may help prevent HC death caused by CDDP57,58. In this study, the P38 MAPK, JNK, and ERK1/2 pathways were activated in response to CDDP exposure. Pretreatment with O-1602 reversed the elevated levels of these proteins, indicating that GPR55 protects against CDDP-induced ototoxicity via suppressing the MAPK pathway. The suppressive effect of GPR55 on the MAPK pathway is consistent with its identity as a GPCR. Other GPCR family members, such as DRD4, have been demonstrated to negatively regulate MAPK signaling through various mechanisms, thereby mediating cytoprotective effects59. Interestingly, in certain models, such as tumor research, reducing GPR55 levels results in decreased MAPK activation60,61. This study highlights the complexity and context-specific characteristics of GPCR signaling. These differences may arise from variations in receptor environments, the distinct properties of interacting proteins, or the diversity of stimuli involved. In the case of CDDP-induced ototoxicity, intense apoptotic stress may selectively activate specific signaling complexes, leading GPR55 to play a protective role by suppressing MAPK activation. Future research will focus on identifying the precise downstream partners involved. In summary, these findings enhance our understanding of GPR55’s function and provide novel strategies for targeting GPCR-MAPK pathways to prevent CDDP-induced hearing loss.
Conclusions
The role of GPR55 in the auditory system was examined. Our results showed that GPR55 is present in the cochlea, with significantly increased expression in cochlear explants and HEI-OC1 cells following CDDP exposure. Furthermore, activation of GPR55 by O-1602 increased HC survival and HEI-OC1 cell viability in vitro, and mitigated CDDP-induced hearing loss, OHC loss, and ribbon synapse degeneration in a mouse model in vivo, indicating the protective effects of O-1602 on the auditory system. In addition, O-1602 suppressed apoptosis and reduced ROS accumulation, primarily through inhibiting the MAPK pathway (as illustrated in Fig. 8, created with BioGDP.com)62. These findings suggest that GPR55 is a promising therapeutic target for combating the ototoxic effects caused by CDDP exposure.
Supplementary Information
Below is the link to the electronic supplementary material.
Funding
This work was supported by the National Natural Science Foundation of China (82201297, 82471178), the Chinese Postdoctoral Science Foundation (2023M740025, 2024M750022).
Data availability
The authors declare that the data supporting the findings of this study are available within the paper and its Supplementary Information files. The sequence data in this study are obtained from the NCBI Sequence Read Archive (SRA) under the accession numbers PRJNA1426777.
Declarations
Competing interests
The authors declare no competing interests.