Maladaptive changes in the homeostasis of AEA-TRPV1/CB1R induces pain-related hyperactivity of nociceptors after spinal cord injury
State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Fudan University, Shanghai, 200438 People’s Republic of China
Department of Physiology and Neurobiology, School of Life Sciences, Fudan University, Shanghai, 200438 People’s Republic of China
Center for Rehabilitation Medicine, Department of Pain Management, Zhejiang Provincial People’s Hospital, Affiliated People’s Hospital, Hangzhou Medical College, Hangzhou, 310014 People’s Republic of China
Key Laboratory of Spine and Spinal Cord Injury Repair and Regeneration, Ministry of Education, Department of Orthopedics, Tongji Hospital, School of Medicine, Tongji University, Shanghai, 200092 People’s Republic of China
Research Institute of Intelligent Complex Systems, Fudan University, Shanghai, 200433 People’s Republic of China
Abstract
Background
Neuropathic pain resulting from spinal cord injury (SCI) is associated with persistent hyperactivity of primary nociceptors. Anandamide (AEA) has been reported to modulate neuronal excitability and synaptic transmission through activation of cannabinoid type-1 receptors (CB1Rs) and transient receptor potential vanilloid 1 (TRPV1). However, the role of AEA and these receptors in the hyperactivity of nociceptors after SCI remains unclear.
Results
In this study, we investigated the effects of AEA and its receptors on the hyperexcitability of mouse dorsal root ganglion (DRG) neurons after SCI. Using a whole-cell patch-clamp technique, we found that the timing of SCI-induced hyperexcitability in nociceptors paralleled an increase in the endocannabinoid AEA content. The expression of TRPV1 and CB1R was also upregulated at different time points after SCI. High-dose extracellular administration of AEA increased the excitability of naive DRG neurons, leading to the transition from a rapidly accommodating (RA) hypoexcitable state to a highly excitable non-accommodating (NA) state. These AEA-induced transitions were facilitated by increased TRPV1 transcription. Pharmacological and Ca2+ imaging experiments revealed that AEA induced hyperexcitability in nociceptors after SCI via the AEA-TRPV1-Ca2+ pathway, whereas activation of CB1Rs reduced SCI-induced hyperexcitability and maintained cytosolic Ca2+ concentration ([Ca2+]cyto) at low levels in the early stages of SCI. As the AEA and TRPV1 levels increased after SCI, adaptive neuroprotection transitioned to a maladaptive hyperactive state, leading to sustained pain.
Conclusions
Taken together, this study provides new insights into how endocannabinoids regulate nociceptor activity after SCI, offering potential targets for the treatment of neuropathic pain.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13578-025-01345-6.
Untitled section
Keywords: Spinal cord injury, Anandamide, DRG, Action potentials, Hyperexcitability
Article notes
Untitled section
Received 2024 Oct 30; Accepted 2025 Jan 2; Collection date 2025.
Background
SCI is one of the most challenging traumatic diseases, leading to damage in both central and peripheral nerves [1]. Nearly half of SCI patients suffer from chronic neuropathic pain for the rest of their lives [2]. Existing treatments aimed at reducing pain have limited effectiveness, partly because the mechanisms that lead to the onset and progression of pain are not fully understood [3]. The hyper-excitation of nociceptors is well-documented as a key factor in neuropathic pain [4]. Following spinal contusion at the thoracic level, nociceptors below the injury exhibit hyperexcitability and spontaneous action potentials (sAPs) for months, correlating with behavioral indicators of pain [5]. Elucidating the mechanisms that promote nociceptor hyperactivity may reveal promising targets for treating neuropathic pain after SCI.
Numerous extrinsic injury-related signals, such as lipopolysaccharide (LPS), pro-inflammatory cytokines, and adenosine triphosphate (ATP), can directly stimulate and sensitize nociceptors [6–9]. However, the role of these signals in promoting nociceptor hyperactivity after SCI is not well understood. According to the hypothesis proposed by Edgar T. Walters, certain signals may be continuously released from the time of injury until the onset of neuropathic pain, causing nociceptors to enter a maladaptive hyperactive state [10]. This results in hyperalgesia and long-term spontaneous pain that develops several months after the injury [11]. Anandamide (N-arachidonoyl-ethanolamine, AEA), an endocannabinoid, acts as an inhibitory retrograde neuromodulator in the central nervous system and provides a neuroprotective effect via the CB1R [12, 13]. Activation of CB1R can inhibit calcium influx by modulating presynaptic voltage-gated calcium channels (VGCCs), inhibiting synaptic transmission [14]. Therefore, the AEA-CB1R signaling pathway is often considered an inhibitory signal in neurotransmission [15]. However, the effect of AEA on pain-related hyperactivity in nociceptors is complex and controversial. For example, AEA levels in the DRG increase following spinal nerve ligation (SNL)-induced neuropathic pain, which is thought to be a homeostatic response to reduce pain [16]. In line with this, reduced AEA levels contribute to pain maintenance in a mouse model of bone cancer [17]. However, an increase in AEA has been suggested to trigger visceral hyperalgesia by altering receptor expression and sensitivity [18].
The dual effect of AEA in sensory afferent modulation is thought to target different endogenous receptors [19]. The effect of AEA could be attributed to its activation of TRPV1, as well as CB1R [20]. TRPV1 is a non-selective cation channel found in sensory neurons [21]. Ions, especially Ca2+, that permeate through TRPV1 channels lead to downstream signaling activation, which further triggers inflammation and facilitates the transmission of pain-related signals [22]. Some evidence suggests that SCI increases the expression of TRPV1 and enhances the sensitivity of isolated nociceptors to TRPV1 agonist capsaicin [23]. However, the potential connection between AEA, its receptors, and the increased activity of nociceptors caused by SCI has not been explored.
In this study, we demonstrate that the increase in AEA following SCI induces hyperexcitability in nociceptors via the AEA-TRPV1 signaling pathway. Furthermore, levels of the neuroprotective receptor CB1R increase in the early stages of SCI. The AEA-CB1R signaling may provide an adaptive neuroprotective effect at the onset of the injury. Due to the upregulation of both AEA and TRPV1, nociceptors transit into a maladaptive state of hyperexcitability and hypersensitivity, contributing to chronic neuropathic pain induced by SCI. These findings may enhance our understanding of how endocannabinoids regulate nociceptor hyperactivity after SCI.
Methods
Animals and injury procedures
Female C57BL/6 mice weighing approximately 20 g and aged between 8 to 10 weeks were maintained in a controlled environment with a 12-h light/dark cycle at a temperature of 22 ± 1 °C. Standard food and water were provided regularly.
SCI was induced as described previously [24, 25]. All animals were anesthetized with inhalant isoflurane (2%) delivered in oxygen-enriched air using a dissecting microscope (Stemi 508, Carl Zeiss, GER) and rodent stereotaxic apparatus (68,037, RWD, CN). First, laminectomy was performed at T8-T10 to expose the spinal cord. Next, SCI was induced at the T9 level by administering a moderate contusion injury (60 kilodynes) using a spinal cord impactor (MASCIS model III, W. M. Keck, USA). For the sham group, only the laminectomy was performed, without subsequent crush injury. Finally, the animals were monitored daily for infection, abnormal wound healing, or weight loss. The mouse’s bladder was manually emptied twice a day until euthanasia. All procedures were approved by the Animal Care and Use Committee of Fudan University and followed the guidelines of the International Association for the Study of Pain.
Dissociation and culture of DRG neurons
DRGs were dissociated using previously described methods [26, 27]. Both sides of the L1-L6 DRGs were isolated in ice-cold Hank’s Balance Salt Solution (HBSS, Gibco, USA) bubbled with 5% CO2 and 95% O2. The tissues were digested with collagenase type I (0.2 mg/mL, Sigma, USA) and dispase II (3 mg/mL, Sigma, USA) at 37℃ for 45 min each. After digestion, tissues were dissociated with a Pasteur pipette and then seeded on poly-D-lysine-coated (0.1 mg/mL, Sigma) coverslips. Neurons were cultured in DMEM/F12 (Gibco, US) supplemented with 10% fetal bovine serum (Gibco, US). For electrophysiological study, cells were used within 12 h after seeding.
Measurement of AEA by LC–MS/MS
DRG samples used for liquid chromatography-mass spectrometry (LC–MS) analysis were prepared using the previously reported method [16, 28]. Briefly, DRGs and spinal cord segments at the L1-L6 level, from both the sham and SCI groups, were homogenized and added to internal standards (AEA-d4, Sigma, USA) containing 2.0 mL of methanol. The supernatants were then extracted with chloroform and centrifuged at 3000 rpm for 10 min at 4 °C. The organic phases were dried under a stream of nitrogen, and the residues were re-dissolved in 2 mL of methanol. All samples were analyzed by mass spectrometry (QTrap 6500, SCIEX, UK) through selected reaction monitoring. For quantitative analysis, the peak area of anandamide ions from the test samples was compared and normalized.
Western blot analysis
L1-L6 DRGs were homogenized and extracted using RIPA lysis buffer (Beyotime, CN) mixed with a protease inhibitor cocktail (Selleckchem, USA). Samples were centrifuged at 12,000 rpm for 10 min at 4℃. The supernatant was separated, and its protein concentration measured using the bicinchoninic acid (BCA) method (Bio-Rad, USA). Based on the protein concentration, samples were diluted with lysis buffer, and 30 μg of protein was loaded into each well. After electrophoresis, the gel was transferred to polyvinylidene fluoride (PVDF) membranes (Merck, USA), which were then blocked with 5% fat-free milk in phosphate buffered saline (PBS) solution with Tween-20. The membrane was incubated overnight at 4℃ with an antibody against TRPV1 (anti-rabbit, 1:400, Alomone, IL), CB1R (anti-rabbit, 1:100, Abcam, UK), or β-actin (anti-mouse, 1:1000, Santa Cruz Biotechnology, USA). After being washed with a PBS solution containing Tween-20, the membrane was incubated at room temperature for 1 h with goat anti-mouse (1:5000, CST, USA) or goat anti-rabbit (1:5000, CST, USA). Protein expression was quantified using enhanced chemiluminescence (ECL) reagent horseradish peroxidase (HRP)-linked secondary antibodies (Thermofisher, USA) and by determining the density of the target band in Image J software (v1.8.0, NIH, USA).
Immunofluorescence
DRG neurons (L4-L5) were fixed in 4% paraformaldehyde (PFA) for 12 h and then dehydrated in a 30% sucrose solution for over 2 nights at 4 °C for 36–48 h. Longitudinal sections of DRG (14 μm) were made using a cryostat (CM1950, Leica, GER), and then incubated with primary antibodies for TRPV1 (1:100, Alomone, IL) and CB1R (1:100, Alomone, IL) in combination with antibodies for neurofilament-200 (NF200, 1:500, Abcam, UK), calcitonin gene-related peptide (CGRP, 1:200, Abcam, UK), and isolectin B4 (IB4, 1:100, Sigma, USA). After washing, the sections were incubated with Cy3 or 488 secondary antibodies (1:500, Beyotime, CN) for 30 min at room temperature (22–24 ℃). All images were captured under identical parameters by a confocal microscope (LSM700, Carl Zeiss, GER). The immunofluorescent staining was quantified using ImageJ software (v1.8.0, NIH, USA).
Electrophysiology
Electrophysiological recordings were performed as described previously [29, 30]. All experiments were performed at room temperature (22–24 ℃). To record the action potential (AP), we used an extracellular solution (300–310 mOsm) with a pH of 7.4 containing the following (in mM): 125 NaCl, 2.5 KCl, 1 MgCl2, 2 CaCl2, 25 NaHCO3, 1.25 NaH2PO4, 25 glucose, 0.4 ascorbic acid, 3 myo-inositol, 2 sodium pyruvate. The intracellular solution (290–300 mOsm) contained (in mM): 125 K-gluconate, 20 KCl, 4 MgATP, 10 Na2-phosphocreatine, 0.3 Na3GTP, 10 HEPES, and 0.5 EGTA at a pH of 7.2. Pipette resistance was 3–6 MΩ, and only small DRG neurons with a soma diameter ≤ 30 μm were selected for recording. sAPs were recorded at the current clamp mode, holding at 0 pA for 3 min. If sAP was not detected and the resting membrane potential was < − 40 mV, the evoked AP (eAP) threshold and spikes were recorded further. The AP threshold was evoked using a series of 5-ms depolarizing current injections in 10 pA steps from − 10 pA. The current that induced the first action potential was defined as 1 × rheobase. NA and RA neurons were identified by stimulating neurons with a 2-s step protocol of 2 × rheobase injection currents to induce AP spike responses. If only a single AP was induced, the neuron was classified as RA. If repetitive AP was observed, the neuron was classified as NA [30]. The custom program for analyzing depolarizing spontaneous fluctuations (DSFs) was written in Python (v3.8.7), which allows us to quantify the irregular curves observed in our recordings. In this study, the minimum amplitude and duration of DSF were defined as 1.5 mV and 10 ms, consistent with a previous study [30, 31].
Single-cell RT-qPCR
After electrophysiological recordings, we amplified the total RNA of single DRGs using a Single-Cell Sequence-Specific Amplification Kit (Vazyme, CN). We used ChamQ Universal SYBR qPCR Master Mix (Bio-Rad, USA) for RT-PCR analysis and analyzed the results with CFX manager software (Bio-Rad, USA). The primers to amplify the target genes are listed in Table 1. All measurements were made three times for each experiment. The β3-tubulin mRNA level was used as an internal reference. Cells with a Ct threshold ≥ 24 (adjusted for primer efficiency and dilution) were not included in the analysis [32]. Pre-amplified cells with Cq values > 35 were defined as not expressing [33].
| Gene name | Oligo primers (5′-3′) | |
|---|---|---|
| Trpv1 | Forward: | TTGTGGAGGTGGCAGATA |
| Reverse: | TCTTGTTGGTGAGTTCTTCT | |
| Trpv2 | Forward: | TGACTCGGCATACACAGA |
| Reverse: | AACATTCGCTCCATTCTCTA | |
| Trpv3 | Forward: | TAACCAGCCTGAGATTGTG |
| Reverse: | AACGAAGTCATTCTGAGTCT | |
| Trpv4 | Forward: | GTCTCGCAAGTTCAAGGA |
| Reverse: | TCTACAGCCAGCATCTCA | |
| Trpm8 | Forward: | TCTTCTACATCGCCTTCCT |
| Reverse: | CCACTGCCTCACTTCATC | |
| Cnr1 | Forward: | TGCTGTTGCTGTTCATTG |
| Reverse: | CACCTTGCCATCTTCTGA | |
| Cnr2 | Forward: | CTTCGCCTTCTGTTCCAT |
| Reverse: | ATACTTCTTCCAGCCTATCAG | |
| Tubb3 | Forward: | CCAGCGGCAACTATGTAG |
| Reverse: | GGTTCCAGGTTCCAAGTC | |
Calcium imaging
For intracellular calcium imaging, DRG neurons were rinsed twice with HBSS (Gibco, USA), which contains calcium and magnesium, to remove the culture medium. The cells were incubated with Fura-2AM (Thermo Fisher Scientific, USA), at a final concentration of 5 μM (dissolved in HBSS), for 40 min at 37℃. After loading the neurons with Fura-2AM, the cultures were washed three times with the extracellular solution (the same solution used for electrophysiology) and incubated for an additional 10 min. The neurons were then moved to the imaging set-up. Fura-2AM signals were captured using a microscope (Eclipse Ti, Nikon, JPN) equipped with a sCMOS camera (ORCA-Flash4.0, Hamamatsu, JPN). The 340/380 light sources were generated by a Lambda DG4 Plus illumination system (Sutter, USA). The cell somas were identified as regions of interest (ROIs) using Metafluor software (Molecular Devices, USA). The basal [Ca2+]cyto was recorded for 120 s and used to normalize the ratio of F340/380 in different groups before AEA administration.
Drug administration
TRPV1 antagonist capsazepine (Alomone, IL), CB1R agonist WIN55,212–2 (Sigma, USA), and CB1R antagonist AM-251 (Sigma, USA) were prepared as stock solutions in DMSO (< 0.1%, Sigma, USA). These solutions were stored as aliquots at -20 °C.
Statistical analysis
Electrophysiological recordings were made using Igor Pro (v9.0.1, WaveMetrics, USA). The results were analyzed in SPSS Statistics (v20.0, IBM, USA) and Prism GraphPad software (v8.01, GraphPad Software Inc, USA). All data were presented as either mean ± SEM or incidence (% of neurons sampled). The normality of the datasets was evaluated using the Shapiro–Wilk test. Normally distributed data were assessed by unpaired Student’s t-test or one-way ANOVA with Dunnett’s post hoc test. Non-normally distributed data were analyzed using the Kruskal–Wallis one-way ANOVA with Dunn’s multiple comparison test. Incidence comparisons were made using Fisher’s exact test with Bonferroni corrections for multiple comparisons. A p value < 0.05 was considered significant.
Results
SCI induces increased AEA content and hyperactivity in nociceptors
Many studies have shown that increased AEA levels may cause hyper-excitation in nociceptors, leading to sustained pain. To examine the changes in AEA content and nociceptor excitability after SCI, we employed an experimental paradigm that included monitoring mouse behavior, assessing AEA content, and making electrophysiological recordings at various time points post-injury (Fig. 1A). Initially, the mice involved in this study had a score of 0 for both hind limbs on the Basso Mouse Scale (BMS) [34] one day after the SCI surgery. The mean scores remained below 3 from 1 to 28 days after the surgery (Fig. 1B). Next, we examined the changes in AEA content in DRGs and the spine below the injury level after SCI using LC–MS/MS. We quantified the level of AEA in DRG extracts using chromatography with AEA-d4 as an internal standard. In the sham group, the average AEA content in L1-L6 DRGs was 10.95 ± 0.54 pmol/g (n = 4; Fig. 1C). In contrast, the AEA content remained unchanged 1 to 7 days post-SCI. However, we observed a significant increase in AEA content 28 days post-SCI (25.32 ± 3.11 pmol/g, n = 4; p < 0.001; Fig. 1C). Similarly, AEA content in the spine below the injury level also increased 28 days post-SCI (Sham: 22.23 ± 0.84 pmol/g, n = 3; SCI day 28: 30.19 ± 1.34 pmol/g, n = 3, p = 0.012; Fig. 1D).
Having shown that the AEA content was significantly increased 28 days post-SCI, we evaluated the neurophysiological activities of DRGs following SCI by recording the sAPs in acutely dissociated DRG neurons with small diameters (≤ 30 μm) at various post-injury time points. The recordings were made in the whole-cell current-clamp configuration. In the sham group, sAPs were observed in only 5 out of 32 neurons (15.6%; Fig. 1E, upper left, F). However, 12 out of 23 neurons exhibited sAPs on 28 days post-SCI (52.2%; p = 0.007; Fig. 1E, lower right, F). The sAP frequency in DRG neurons significantly increased compared to the sham group 28 days post-SCI (Sham: 0.04 ± 0.03 Hz, n = 32; SCI: 0.21 ± 0.06 Hz, n = 23; p = 0.002; Fig. 1E, G). In addition, we observed significant depolarization of resting membrane potential (RMP) 28 days post-SCI (Sham: -60.2 ± 1.5 mV, n = 32; SCI: -51.4 ± 1.3 mV, n = 23; p < 0.001; Fig. 1H). However, no significant alterations were observed 1 and 7 days post-SCI in terms of sAP probability (Fig. 1G), or RMP (Fig. 1H) compared to the sham group. We also measured changes in the rheobase among the sham group and three time points post-SCI. Our results showed that rheobase was decreased only 28 days post-SCI compared to the sham group (Sham: 123.8 ± 18.5 pA, n = 13; SCI day 28: 73.0 ± 5.1 pA, n = 46; p = 0.037; Fig. 1I). These results suggest that the timing of SCI-induced hyperexcitability in nociceptors is paralleled by an increase in AEA content.
TRPV1 and CB1R are upregulated in nociceptors following SCI
AEA regulates neuronal excitability via activation of its receptors TRPV1 and CB1R. To investigate how the sensitivity of pain receptors is altered after SCI, we further examined the expression of TRPV1 and CB1R in DRG neurons following SCI using Western blot analysis. TRPV1 protein levels were significantly higher 28 days post-SCI compared to the sham group (Sham: 1.0, n = 4; SCI day 28: 1.7 ± 0.1, n = 4; p = 0.016; Fig. 2A, B, left). However, the levels remained unchanged in DRG neurons 1 and 7 days post-SCI (Fig. 2A, B, left). These findings are consistent with a previous report showing increased TRPV1 levels post-SCI [23]. Interestingly, changes in CB1R occurred earlier than changes in TRPV1. We observed an increase in CB1R levels 7 and 28 days after SCI, but no change in CB1R expression was observed in DRG neurons 1 day after SCI (Sham: 1.0, n = 4; SCI day 7: 1.4 ± 0.04, n = 4, p = 0.018; SCI day 28: 1.8 ± 0.2, n = 4, p = 0.001; Fig. 2A, B, right).
To identify specific cell types with increased TRPV1 following SCI, we used immunohistochemistry to examine the co-localization with CGRP, IB4, and NF200, which are markers of peptidergic C-type, nonpeptidergic C-type, and A-type neurons, respectively. Compared to the sham group (CGRP: 72.4 ± 4.7%, n = 3; IB4: 46.9 ± 4.2%, n = 4; NF200: 39.3 ± 5.2%, n = 3; Fig. 2C, D), the number of neurons expressing TRPV1 significantly increased in chronic nociceptor markers labeled with IB4 and CGRP, but not in NF200-labeled DRG neurons, 28 days post-SCI (CGRP: 93.5 ± 1.6%, n = 3, p = 0.014; IB4: 75.5 ± 4.1%, n = 3, p = 0.005; NF200: 55.2 ± 5.9%, n = 3, p = 0.116; Fig. 2C, D). Compared to the sham group (CGRP: 68.4 ± 2.2%, n = 4; IB4: 59.1 ± 5.1%, n = 4; NF200: 51.8 ± 5.8%, n = 4; Fig. 2E, F), the proportions of all three neuron types expressing CB1R significantly increased in DRG neurons 28 days post-SCI (CGRP: 85.7 ± 3.0%, n = 4, p = 0.004; IB4: 84.6 ± 1.4%, n = 3, p = 0.009; NF200: 87.9 ± 5.6%, n = 4, p = 0.004; Fig. 2E, F). These results suggest that the expression of TRPV1 and CB1R increases over time after SCI. More specifically, TRPV1 is primarily increased in neurons associated with chronic pain.
High-dose AEA application on naive DRG can mimic the effects of SCI on nociceptors
To clarify the specific effect of increased AEA levels on nociceptors post-SCI, DRG neurons isolated from both adult naive (adult mice that have not undergone any surgical procedures or interventions) and SCI mice at 28 days post-injury were exposed to AEA for 30 min. The AEA doses ranged from 0.01 to 1 μM, which closely match the reported ranges in acute and chronic rat spinal cords post-SCI (0.05–0.4 μM) [35, 36]. The sAPs were recorded under the current clamp configuration. In the naive group, sAP was observed in only 4 out of 21 DRG neurons (19.0%; Fig. 3A, B), whereas 12 out of 23 cells exhibited sAP in the presence of 1 μM AEA (52.2%; p = 0.031; Fig. 3A, B). No significant alterations in the probability of sAP were observed in the presence of 0.01 μM or 0.1 μM AEA (Fig. 3A, B). We also observed a significant increase in the sAP frequency in the presence of 1 μM AEA compared to the naive group, but not with 0.01 μM or 0.1 μM AEA (Naive: 0.06 ± 0.05 Hz, n = 21; Naive + 1 μM AEA: 0.68 ± 0.26 Hz, n = 23, p = 0.027; Fig. 3A, C).
We also investigated the effect of AEA on RMP. RMP was elevated in both the 0.1 μM AEA and 1 μM AEA groups compared to the naive group (Naive: -61.8 ± 1.0 mV, n = 21; 0.1 μM AEA: -52.8 ± 1.2 mV, n = 19, p < 0.001; Naive + 1 μM AEA: -51.6 ± 1.0 mV, n = 23, p < 0.001; Fig. 3A, D).
Following an injury, spontaneous activities can lead to DSFs in membrane potential [37]. We assessed these DSFs using an automated analysis similar to the method reported previously [30]. Our findings showed significantly increased DSF amplitudes when treated with 0.1 μM or 1 μM AEA in the Naive group (Naive: 2.19 ± 0.10 mV, n = 21; Naive + 0.1 μM AEA: 3.20 ± 0.19 mV, n = 19, p = 0.001; Naive + 1 μM AEA: 3.70 ± 0.23 mV, n = 23, p < 0.001; Fig. 3E, F). Large DSFs, defined by amplitudes > 5 mV, can be elicited occasionally [30]. In the naive group, large DSFs was observed in only 3 out of 21 DRG neurons (14.3%; Fig. 3G). However, administration of 1 μM AEA significantly increased the incidence of large DSFs to 47.8% (11 out of 23 neurons, p = 0.028; Fig. 3G). No significant changes were observed in the incidence of large DSFs in the presence of 0.01 μM or 0.1 μM AEA (Fig. 3G). In addition, rheobase was decreased in the group treated with 1 μM AEA compared to the naive group (Naive: 106.4 ± 8.0 pA, n = 47; Naive + 1 μM AEA: 70.5 ± 7.5 pA, n = 19, p = 0.029; Fig. 3H).
However, AEA did not exacerbate these hyperexcitable effects at any of the tested concentrations after SCI, possibly due to a ceiling effect. This includes the probability of sAP, the sAP frequency, RMP, DSF amplitudes, the incidence of large DSFs, and rheobase (Fig. 3). These results imply that the AEA concentration-dependent increase in neuronal excitability observed in the naive group is similar to the high neuronal excitability observed after SCI.
AEA application after SCI promotes TRPV1-dependent transformation of AP
Nociceptors were classified in vitro as either RA or NA types based on their AP responses to a depolarizing current at twice the rheobase, a measure of induced neuronal excitability (Fig. 4A) [30]. External stimuli can induce transitions between these states [31]. Application of 1 μM or 0.1 μM AEA promoted the transition from RA to NA type and increased the occurrence of NA neurons compared to the naive group (Naive: 44.7%, 21 out of 47 neurons; Naive + 0.1 μM AEA: 75.0%, 15 out of 20 neurons, p = 0.032; Naive + 1 μM AEA: 100.0%, 19 out of 19 neurons, p < 0.001; Fig. 4B). However, this transition was eliminated by the presence of 0.01 μM AEA. Interestingly, we found that, though the AEA response to spontaneous neuronal activity was not further enhanced after SCI, AEA-induced transitions from RA to NA type were triggered by pre-treatment with lower AEA concentrations in the SCI group (SCI: 45.7%, 21 out of 46 neurons; SCI + 0.01 μM AEA: 100.0%, 13 out of 13 neurons, p < 0.001; SCI + 0.1 μM AEA: 100.0%, 15 out of 15 neurons, p < 0.001; SCI + 1 μM AEA: 100.0%, 13 out of 13 neurons, p < 0.001; Fig. 4B). This suggests an increased sensitivity of DRG neurons to AEA in inducing the transition from an RA to NA state following the injury.
To investigate the factors associated with the increased sensitivity of AEA post-SCI, we measured mRNA expression of the TRP family, Cnr1, and Cnr2 in these neurons by single-cell qPCR following the determination of electrophysiological properties. We found that the TRP family, Cnr1, and Cnr2 were expressed in all DRG neurons examined in both the naive and SCI groups. The transcript expression patterns fell into three categories: high expression (Trpv1: Naive, 76.6%, SCI, 80.4%; Cnr1: Naive, 95.7%, SCI, 100.0%; Cnr2: Naive, 97.9%, SCI, 100.0%), moderate expression (Trpv3: Naive, 63.8%, SCI, 47.8%; Trpv4: Naive, 51.1%, SCI, 41.3%), or low expression (Trpv2: Naive, 29.8%, SCI, 26.1%; Trpm8: Naive, 34.0%, SCI, 37.0%) (Fig. 4C, D).
We further analyzed the expression of these genes at the transcriptional level in NA and RA neurons. SCI led to an increase in Trpv1 transcription in RA neurons, as the relative mRNA level was significantly increased compared to the naive group (Naive: 9.1 ± 1.2, n = 19; SCI: 5.2 ± 1.0, n = 22; p = 0.028; Fig. 4E). However, no significant differences were observed in Trpv1 transcription levels in NA neurons between the naive and SCI groups (Fig. 4E). Furthermore, we found no significant differences in the transcription levels of Trpv4 (Fig. 4F), Cnr1 (Fig. 4G), and Cnr2 (Fig. 4H) in both NA and RA neurons between the naive and SCI groups. These findings suggest that TRPV1 may play a key role in increasing the sensitivity of DRG neurons to AEA in the RA-NA state transformation following SCI.
AEA induces hyperactivity in nociceptors via activation of TRPV1
Having shown that AEA can potentiate neuronal activity after SCI, we further explored the downstream pathway involved in the induction of hyperactivity. We applied the TRPV1 antagonist (capsazepine, CAPZ, 10 μM) or CB1R antagonist (AM-251, 1 μM) to naive DRG neurons 1 h before the electrophysiological recording. Subsequently, DRG neurons isolated from naive mice were exposed to 1 μM AEA for 30 min. We found that the reversal of AEA-induced hyperactivity was linked to pre-treatment with CAPZ, not AM-251. This includes changes in the sAP probability and frequency, RMP, DSF amplitude, incidence of large DSFs, rheobase, and the incidence of an NA state (Fig. 5A–F, Table 2). These findings suggest that SCI-induced hyperexcitability primarily stems from activation of TRPV1 by increased AEA levels.
| Property | Naive | AEA | CAPZ + AEA | AM251 + AEA | Test |
|---|---|---|---|---|---|
| Cells with sAP (%) | 19.0 | 52.2 | 6.7 | 33.3 | Fisher’s exact test: Naive vs. AEA, p = 0.031; AEA vs. CAPZ + AEA, p = 0.005 |
| Frequency (Hz) | 0.06 ± 0.05 | 0.68 ± 0.26 | 0.02 ± 0.02 | 0.41 ± 0.24 | K–W test: Naive vs. AEA, p = 0.049; AEA vs. CAPZ + AEA, p = 0.013 |
| RMP (mV) | − 61.8 ± 1.0 | − 51.6 ± 1.0 | − 56.4 ± 1.0 | − 49.4 ± 2.7 | K–W test: Naive vs. AEA, p < 0.001; Naive vs. AM251 + AEA, p < 0.001 |
| DSF amplitude (mV) | 2.19 ± 0.10 | 3.70 ± 0.23 | 2.79 ± 0.13 | 3.35 ± 0.19 | One-way ANOVA: Naive vs. AEA, p < 0.001; Naive vs. AM251 + AEA, p = 0.001; AEA vs. CAPZ + AEA, p = 0.003 |
| Large DSF (%) | 14.3 | 47.8 | 13.3 | 55.6 | Fisher’s exact test: Naive vs. AEA, p = 0.025; Naive vs. AM251 + AEA, p = 0.032; AEA vs. CAPZ + AEA, p = 0.039 |
| Rheobase (pA) | 106.4 ± 8.0 | 70.5 ± 7.5 | 120.7 ± 10.4 | 64.6 ± 4.6 | K–W test: Naive vs. AEA, p = 0.041; Naive vs. AM251 + AEA, p = 0.022; AEA vs. CAPZ + AEA, p = 0.006; Naive vs. CAPZ + AEA, p = 0.003 |
| NA neuron incidence (%) | 44.7 | 100.0 | 46.7 | 90.9 | Fisher’s exact test: Naive vs. AEA, p < 0.001; Naive vs. AM251 + AEA, p < 0.001; AEA vs. CAPZ + AEA, p = 0.007 |
TRPV1 inhibitor or CB1R agonist eliminates SCI-induced hyperexcitability
Our results indicate that AEA enhances neuronal excitability after SCI via activated TRPV1, but the significance of elevated CB1R levels after SCI remains unclear. Therefore, we applied CAPZ (10 μM) or the exogenous cannabinoid agonist WIN55212-2 (WIN, 1 μM) [38] for 1 h to inhibit TRPV1 or activate CB1R in DRG neurons 28 days post-SCI. We then assessed the neurophysiological activity via whole-cell recordings. Administration of either CAPZ or WIN reduced SCI-induced hyperexcitability, including the sAP probability and frequency, RMP, DSF amplitude, incidence of large DSFs, and rheobase. However, the proportion of NA neurons remained unchanged in the absence of AEA (Fig. 6A–F, Table 3). In summary, inhibiting TRPV1 or activating CB1R can reduce the SCI-induced hyperexcitability of DRG neurons in vitro.
| Property | Sham | SCI | SCI + CAPZ | SCI + WIN55212-2 | Test |
|---|---|---|---|---|---|
| Cells with sAP (%) | 15.6 | 52.2 | 6.7 | 12.5 | Fisher’s exact test: Sham vs. SCI, p = 0.007; SCI vs. CAPZ, p = 0.005; SCI vs. WIN, p = 0.017 |
| Frequency (Hz) | 0.04 ± 0.03 | 0.21 ± 0.06 | 0.01 ± 0.01 | 0.04 ± 0.04 | K–W test: Sham vs. SCI, p = 0.006; SCI vs. CAPZ, p = 0.006; SCI vs. WIN, p = 0.021 |
| RMP (mV) | − 60.2 ± 1.5 | − 51.4 ± 1.3 | − 54.1 ± 1.2 | − 55.2 ± 1.5 | One-way ANOVA: Sham vs. SCI, p < 0.001; Sham vs. SCI, p = 0.036 |
| DSF amplitude (mV) | 2.36 ± 0.19 | 4.00 ± 0.20 | 2.71 ± 0.15 | 2.67 ± 0.16 | K–W test: Sham vs. SCI, p < 0.001; SCI vs. CAPZ, p = 0.012; SCI vs. WIN, p = 0.004 |
| Large DSF (%) | 18.8 | 65.2 | 13.3 | 25.0 | Fisher’s exact test: Sham vs. SCI, p = 0.001; SCI vs. CAPZ, p = 0.038; SCI vs. WIN, p = 0.030 |
| Rheobase (pA) | 123.8 ± 18.5 | 73.0 ± 5.1 | 110.0 ± 12.2 | 118.3 ± 11.1 | K–W test: Sham vs. SCI, p = 0.002; SCI vs. CAPZ, p = 0.043; SCI vs. WIN, p = 0.008 |
| NA neuron incidence (%) | 58.8 | 45.7 | 66.7 | 83.3 | Fisher’s exact test: n.s |
Increased sensitivity of AEA-TRPV1 increases cytosolic calcium after SCI
AEA increases cytosolic Ca2+ by activating the non-selective cation channel TRPV1, leading to the potentiation of pain-related neurotransmission. Conversely, CB1R activation can inhibit calcium influx by modulating presynaptic VGCCs [14]. To investigate the effects of AEA on cytosolic calcium after SCI, we used calcium imaging to measure the [Ca2+]cyto before and after AEA administration at various concentrations in both the naive and SCI groups. After obtaining a baseline [Ca2+]cyto for 120 s as a control, AEA was applied to DRG neurons (≤ 30 μm) in vitro. In the naive group, 12 out of 46 neurons (26.1%) showed responses to 0.01 μM AEA, whereas 20 out of 37 neurons (54.1%) responded to the same concentration 28 days post-SCI (p = 0.002; Fig. 7A). At higher AEA concentrations (0.1 μM or 1 μM), we found no significant difference in the proportion of responding neurons (Fig. 7B, C). Subsequently, we found that responding neurons in the naive and SCI groups had different levels of increase in [Ca2+]cyto after AEA administration. Approximately 1200 s after administering 0.01 μM AEA, the [Ca2+]cyto of responding neurons in the naive group increased to 129.5 ± 9.9% compared to baseline (Fig. 7D). We observed a higher increase in [Ca2+]cyto in response to 0.01 μM AEA 28 days post-SCI compared to the naive group (194.8 ± 20.2%; p = 0.018; Fig. 7D). Similarly, there was a higher increase in [Ca2+]cyto in response to 0.1 μM AEA 28 days post-SCI compared to the naive group (Naive: 144.8 ± 7.6%; SCI: 210.5 ± 29.0%; p = 0.042; Fig. 7E). However, no significant changes were observed in the presence of 1 μM AEA (Fig. 7F). These findings suggest that AEA induces more calcium influx into the DRG neurons after SCI than in the naive group.
As to why AEA induces a greater [Ca2+]cyto increase following SCI than in the naive group, we propose two hypotheses. First, despite the enduring inhibitory effect of CB1R on calcium influx post-SCI, the overall impact of AEA may still lean towards increasing the calcium influx due to TRPV1 upregulation. Second, the function of CB1R may shift to promote intracellular calcium influx after SCI. To explore the factors leading to changes in the effects of AEA on cytosolic calcium after SCI, we applied CAPZ (10 μM) or AM-251 (1 μM) to neurons 28 days post-SCI starting 30 min prior to intracellular calcium imaging. Subsequently, we administered 0.01 μM AEA to neurons after obtaining a baseline [Ca2+]cyto for 120 s as a control. Although pre-treatment with AM-251 did not further increase the peak value of [Ca2+]cyto, it affected the timing of the response. Compared to the group without pre-treatment, we observed a faster increase in [Ca2+]cyto following administration of 0.01 μM AEA in the AM-251 pre-treatment group (Fig. 7G). This suggests an inhibitory effect of CB1R on calcium influx post-SCI. Furthermore, we did not observe a significant increase in [Ca2+]cyto after administering 0.01 μM AEA with CAPZ pre-treatment (Fig. 7G), implying an increase in [Ca2+]cyto due to TRPV1 activation.
Discussion
Chronic peripheral sensitization of nociceptors drives neural pathways that result in sustained pain after SCI [39, 40]. In the present study, we found that an increase in AEA content after SCI leads to hyperexcitability in nociceptors via the AEA-TRPV1 signaling pathway. We also observed an early-stage increase in the neuroprotective receptor CB1R, suggesting a potential adaptive neuroprotective role for AEA-CB1R signaling shortly after SCI. However, due to the increase in both AEA and TRPV1, nociceptors transition to a maladaptive state marked by hyperexcitability and hypersensitivity, which contributes to the development of chronic neuropathic pain post-SCI (Fig. 8).
Pathological alterations in AEA-TRPV1 lead to hyperexcitability of nociceptors after SCI
How AEA is altered at the spinal level under pathological conditions, such as neuropathic pain, is still controversial [41]. Previous studies suggested that AEA levels increase in the spinal cord and DRGs after peripheral nerve injuries [16, 42, 43]. However, Kinsey et al. indicated no significant change in AEA levels in the spinal cord after such an injury [44]. The international SCI pain classification divides neuropathic pain post-SCI into “at-level” and “below-level” pain [45]. We observed a significant increase in AEA content in DRGs and the spine below the injury level 28 days post-SCI (Fig. 1), indicating activation of the endocannabinoid system as a compensatory mechanism. This activation may reduce neuronal excitability and modulates pain and inflammation [14]. Furthermore, disruption of the endocannabinoid system homeostasis by activated glial cells after SCI may contribute to this increase [46].
Previous studies investigated AEA changes after SCI and found no significant difference in AEA in the epicenter and rostral region between 28 days post-SCI and the sham group [36]. However, AEA increased in the early stages of the injury [35]. The varying levels of AEA in different spinal levels could be due to the different characteristics and pathological mechanisms of these pain types. Supporting this, [5] found that sAP incidence did not increase in DRG neurons above the T10 contusion site, but it significantly increased in DRG neurons below the contusion site. We also observed that the timing of the sAP increase in nociceptors is consistent with the increase in AEA content below the injury level (Fig. 1). This implies that SCI-induced hyperexcitability in nociceptors is related to the increased AEA content.
Recent studies indicate that an increase in excitatory or sensitizing signals, or a decrease in inhibitory signals, may contribute to persistent nociceptor hyperactivity [37]. However, some external signals modulate pain-related hyperactivity via a variety of mechanisms. For example, SCI induces an increase in the release of macrophage migration inhibitory factor (MIF) in nociceptors. Though low MIF levels excite nociceptors, higher levels induce a hypoexcitable state [31]. AEA is generally considered an inhibitory chemical signal due to its ability to enhance CB1R-mediated pain relief in central nerves, but our study found that increased AEA in DRGs after SCI may pathologically shift the state from anti-nociceptive to pro-nociceptive. One possible mechanism for this pathological change could be the concentration of AEA. We demonstrated that the administration of 1 μM AEA can mimic the pathological behavior of nociceptors after SCI, whereas a low dose of AEA had no effect (Fig. 3). Our findings are in line with previous studies suggesting that low concentrations of AEA primarily exert a CB1R-mediated anti-nociception effect, whereas high concentrations of AEA stimulate TRPV1, exciting nociceptors and causing the release of neuropeptides into the dorsal spinal cord, producing the nociceptive effect [19, 47]. Another potential mechanism could be changes in the inherent sensitivity that promote nociceptor hyperactivity [10]. When the balance between TRPV1 and CB1R is disrupted following injury, the sensitivity to external chemical signals, including AEA, increases, leading to excitation.
The extracellular environment can change both the intrinsic sensitivity and expression of receptors. For example, under neuroinflammatory conditions following SCI, such as in the presence of bradykinin or prostaglandins, the sensitivity of TRPV1 to AEA is increased [48]. Our study observed a parallel increase in AEA and TRPV1 in DRG after SCI (Fig. 2). S Hong et al. also found that exposing naive DRG neurons to high concentrations of AEA in vitro enhances TRPV1 expression [18]. This led us to hypothesize that the increase in TRPV1 post-SCI may be due to the increased AEA levels. However, whether externally inhibiting AEA production can inhibit the upregulation of TRPV1, thus potentially reducing pain, remains unclear.
Adaptive changes in CB1R may serve as a protective response to inhibit SCI-induced hyperexcitability
When exposed to nociceptive stimuli, protective receptors undergo adaptive changes [49]. Our study found an early increase in CB1R after SCI. This suggests that the increased expression of CB1R in both CGRP- and IB4-positive neurons, which are associated with C-fibers, could act as a protective response to inhibit SCI-induced hyperexcitability. Interestingly, an increase in CB1R was also noticed in large DRG neurons identified by NF200, a non-nociceptive mechanoreceptor marker [50]. Although the impact of and changes in CB1R on primary receptors after SCI are not fully understood, several studies have investigated its function in the brain and spinal cord. An increase in CB1R during the early stages of SCI has been suggested to assist in motor function recovery following incomplete SCI [35]. Other studies suggest that interactions among CB1R, C–C chemokines, and TRPV1 may contribute to SCI-induced brain alterations, leading to emotional-affective pain responses and the development of central pain after SCI [51].
Electrophysiological state transitions and hyperexcitability mechanisms post-SCI
Odem et al. [30] identified two electrophysiological states of DRG neurons under stimulated conditions, termed the NA and RA states. Following SCI, the increase in sAP is driven primarily by NA neurons. In vitro, NA neurons made up 69% of the population, whereas RA neurons made up 31%, a ratio similar to our findings. The NA-RA state changes with the external signal [31], suggesting that NA and RA represent distinct functional states, not fixed phenotypes. The RA-NA transformation represents a shift in neuronal adaptability to sustained stimuli, with RA neurons maintaining a hypoexcitable state and NA neurons exhibiting repetitive firing in response to prolonged stimuli [30]. Clinically, these mechanisms may manifest as distinct symptoms. sAPs are closely linked to spontaneous and persistent pain, while the RA-NA transformation may explain contrasting symptoms such as hypoalgesia (RA neurons) and hyperalgesia/allodynia (NA neurons) [5, 30]. Notably, the RA-NA state transformation could represent a broader adaptation mechanism influencing neuronal behavior beyond nociceptive pathways. Our study linked these electrophysiologically defined neuron types to molecular markers using single-cell PCR. We found that the potential for transition between NA and RA types is related to the expression of TRPV1 mRNA. This correlation clarifies the increased sensitivity to AEA in inducing TRPV1-dependent transition from the RA to NA state following injury. Understanding these connections could provide valuable insights into targeting TRPV1 or modifying the RA-NA balance as therapeutic strategies for neuropathic pain management.
We also found that AEA can dose-dependently and persistently increase DSFs, mimicking the random fluctuations in RMP observed post-SCI (Fig. 3). This heightened excitability can be reduced by inhibiting TRPV1 or activating CB1 receptors (Figs. 5 and 6). Previous studies identified DSFs as transient components of RMP, associated with the irregular firing patterns of nociceptor sAP [30]. Under the hyperactive conditions of neuropathic pain, the increase in DSFs contributes to spontaneous activity [52]. However, the biophysical and cellular signaling mechanisms underlying the generation and amplification of DSFs remain unclear. Our findings provide additional insights into the mechanisms of DSFs, which could help create more precise treatments for spontaneous pain.
Regulation of cytosolic calcium by CB1R and TRPV1 in neuropathic pain after SCI
Ca2⁺ plays a crucial role in maintaining the normal function of the nervous system and regulating its dynamic changes [53]. Our study suggests that CB1R and TRPV1 can regulate cytosolic calcium levels after SCI, which has also been shown in many other cases. For example, nerve growth factor (NGF) levels increase during inflammation, injury, or chronic pain states [54, 55]. Applying high levels of NGF in vitro increases the proportion of intracellular calcium flow in DRG neurons after AEA activates TRPV1. In addition, in the presence of high NGF, crosstalk between receptors CB1R and TRPV1 is enhanced, further increasing calcium inflow induced by the AEA-TRPV1 pathway [56]. However, we found that CB1R agonists can still inhibit the excitability of DRG neurons after SCI, suggesting that the upregulated CB1R following SCI can continue to exert inhibitory effects. This finding suggests a promising analgesic strategy using the combination of CB1R agonists and TRPV1 inhibitors for neuropathic pain after SCI.
Conclusions
In conclusion, increased AEA content post-SCI induces nociceptor hyperexcitability via the AEA-TRPV1 pathway. An early increase in CB1R suggests adaptive neuroprotection by AEA-CB1R signaling. However, increasing levels of AEA and TRPV1 lead to nociceptor maladaptation, contributing to chronic neuropathic pain post-SCI. This evidence suggests that endocannabinoids and their receptors are altered in a specific manner in the pathological state of SCI, which may support a more targeted approach to the development of cannabinoid-based pain medications.
Supplementary Information
Acknowledgements
Not applicable.
Abbreviations
- ATP
- Adenosine triphosphate
- AEA
- Anandamide (N-arachidonoyl-ethanolamine)
- BMS
- Basso Mouse Scale
- BCA
- Bicinchoninic acid
- CGRP
- Calcitonin gene-related peptide
- CAPZ
- Capsazepine
- DSFs
- Depolarizing spontaneous fluctuations
- ECL
- Enhanced chemiluminescence
- eAP
- Evoked action potentials
- HRP
- Horseradish peroxidase
- IB4
- Isolectin B4
- LPS
- Lipopolysaccharide
- MIF
- Macrophage migration inhibitory factor
- NGF
- Nerve growth factor
- NF200
- Neurofilament-200
- PFA
- Paraformaldehyde
- PBS
- Phosphate buffered saline
- PVDF
- Polyvinylidene fluoride
- ROIs
- Regions of interest
- SNL
- Spinal nerve ligation
- sAPs
- Spontaneous action potentials
- VGCCs
- Voltage-gated calcium channels
- WIN
- WIN55212-2
Funding
This work was sponsored by the National Key Research & Development Program of China (2022YFC3602700&2022YFC3602702), the Science and Technology Innovation 2030—Brain Science and Brain-Inspired Intelligence Project (2021ZD0201301) and the National Natural Science Foundation of China (32170688).
Availability of data and materials
Data are available upon reasonable request. Please contact the corresponding author.
Declarations
Ethics approval and consent to participate
The animal study was approved by the Animal Care and Use Committee of Fudan University and followed the guidelines of the International Association for the Study of Pain.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing financial interests.
Footnotes
Footnote Group
References
Untitled section
References
- 1.Hellenbrand DJ, Quinn CM, Piper ZJ, Morehouse CN, Fixel JA, Hanna AS. Inflammation after spinal cord injury: a review of the critical timeline of signaling cues and cellular infiltration. J Neuroinflammation. 2021;18(1):284.
- 2.Shiao R, Lee-Kubli CA. Neuropathic pain after spinal cord injury: challenges and research perspectives. Neurotherapeutics. 2018;15(3):635–53.
- 3.Widerström-Noga E. Neuropathic pain and spinal cord injury: management, phenotypes, and biomarkers. Drugs. 2023;83(11):1001–25.
- 4.North RY, Odem MA, Li Y, Tatsui CE, Cassidy RM, Dougherty PM, et al. Electrophysiological alterations driving pain-associated spontaneous activity in human sensory neuron somata parallel alterations described in spontaneously active rodent nociceptors. J Pain. 2022;23(8):1343–57.
- 5.Bedi SS, Yang Q, Crook RJ, Du J, Wu Z, Fishman HM, et al. Chronic spontaneous activity generated in the somata of primary nociceptors is associated with pain-related behavior after spinal cord injury. J Neurosci. 2010;30(44):14870–82.
- 6.Stein A, Panjwani A, Sison C, Rosen L, Chugh R, Metz C, et al. Pilot study: elevated circulating levels of the proinflammatory cytokine macrophage migration inhibitory factor in patients with chronic spinal cord injury. Arch Phys Med Rehabil. 2013;94(8):1498–507.
- 7.Xue MT, Sheng WJ, Song X, Shi YJ, Geng ZJ, Shen L, et al. Atractylenolide III ameliorates spinal cord injury in rats by modulating microglial/macrophage polarization. CNS Neurosci Ther. 2022;28(7):1059–71.
- 8.Chu J, Yang J, Zhou Y, Chen J, Chen KH, Zhang C, et al. ATP-releasing SWELL1 channel in spinal microglia contributes to neuropathic pain. Sci Adv. 2023;9(13):eade9931.
- 9.Hashemizadeh S, Hosseindoost S, Omidi A, Aminianfar H, Ebrahimi-Barough S, Ai J, et al. Novel therapeutic approach to slow down the inflammatory cascade in acute/subacute spinal cord injury: early immune therapy with lipopolysaccharide enhanced neuroprotective effect of combinational therapy of granulocyte colony-stimulating factor and bone-marrow mesenchymal stem cell in spinal cord injury. Front Cell Neurosci. 2022;16: 993019.
- 10.Walters ET. Adaptive mechanisms driving maladaptive pain: how chronic ongoing activity in primary nociceptors can enhance evolutionary fitness after severe injury. Philos Trans R Soc Lond B Biol Sci. 2019;374(1785):20190277.
- 11.Finnerup NB, Norrbrink C, Trok K, Piehl F, Johannesen IL, Sørensen JC, et al. Phenotypes and predictors of pain following traumatic spinal cord injury: a prospective study. J Pain. 2014;15(1):40–8.
- 12.Li H, Chen R, Zhou Y, Wang H, Sun L, Yang Z, et al. Endocannabinoids regulate cocaine-associated memory through brain AEA-CB1R signalling activation. Mol Metab. 2022;65: 101597.
- 13.Castillo PE, Younts TJ, Chávez AE, Hashimotodani Y. Endocannabinoid signaling and synaptic function. Neuron. 2012;76(1):70–81.
- 14.Wu Y, Liu Q, Guo B, Ye F, Ge J, Xue L. BDNF activates postsynaptic TrkB receptors to induce endocannabinoid release and inhibit presynaptic calcium influx at a calyx-type synapse. J Neurosci. 2020;40(42):8070–87.
- 15.Freund TF, Katona I, Piomelli D. Role of endogenous cannabinoids in synaptic signaling. Physiol Rev. 2003;83(3):1017–66.
- 16.Mitrirattanakul S, Ramakul N, Guerrero AV, Matsuka Y, Ono T, Iwase H, et al. Site-specific increases in peripheral cannabinoid receptors and their endogenous ligands in a model of neuropathic pain. Pain. 2006;126(1–3):102–14.
- 17.Khasabova IA, Holman M, Morse T, Burlakova N, Coicou L, Harding-Rose C, et al. Increased anandamide uptake by sensory neurons contributes to hyperalgesia in a model of cancer pain. Neurobiol Dis. 2013;58:19–28.
- 18.Hong S, Fan J, Kemmerer ES, Evans S, Li Y, Wiley JW. Reciprocal changes in vanilloid (TRPV1) and endocannabinoid (CB1) receptors contribute to visceral hyperalgesia in the water avoidance stressed rat. Gut. 2009;58(2):202–10.
- 19.Tognetto M, Amadesi S, Harrison S, Creminon C, Trevisani M, Carreras M, et al. Anandamide excites central terminals of dorsal root ganglion neurons via vanilloid receptor-1 activation. J Neurosci. 2001;21(4):1104–9.
- 20.Muller C, Morales P, Reggio PH. Cannabinoid ligands targeting TRP channels. Front Mol Neurosci. 2018;11:487.
- 21.Cevikbas F, Wang X, Akiyama T, Kempkes C, Savinko T, Antal A, et al. A sensory neuron-expressed IL-31 receptor mediates T helper cell-dependent itch: Involvement of TRPV1 and TRPA1. J Allergy Clin Immunol. 2014;133(2):448–60.
- 22.Lv Z, Xu X, Sun Z, Yang YX, Guo H, Li J, et al. TRPV1 alleviates osteoarthritis by inhibiting M1 macrophage polarization via Ca(2+)/CaMKII/Nrf2 signaling pathway. Cell Death Dis. 2021;12(6):504.
- 23.Wu Z, Yang Q, Crook RJ, O’Neil RG, Walters ET. TRPV1 channels make major contributions to behavioral hypersensitivity and spontaneous activity in nociceptors after spinal cord injury. Pain. 2013;154(10):2130–41.
- 24.Luchetti S, Beck KD, Galvan MD, Silva R, Cummings BJ, Anderson AJ. Comparison of immunopathology and locomotor recovery in C57BL/6, BUB/BnJ, and NOD-SCID mice after contusion spinal cord injury. J Neurotrauma. 2010;27(2):411–21.
- 25.Berkey SC, Herrera JJ, Odem MA, Rahman S, Cheruvu SS, Cheng X, et al. EPAC1 and EPAC2 promote nociceptor hyperactivity associated with chronic pain after spinal cord injury. Neurobiol Pain. 2020;7: 100040.
- 26.Xie YK, Luo H, Zhang SX, Chen XY, Guo R, Qiu XY, et al. GPR177 in A-fiber sensory neurons drives diabetic neuropathic pain via WNT-mediated TRPV1 activation. Sci Transl Med. 2022;14(639):eabh2557.
- 27.Xia LP, Luo H, Ma Q, Xie YK, Li W, Hu H, et al. GPR151 in nociceptors modulates neuropathic pain via regulating P2X3 function and microglial activation. Brain. 2021;144(11):3405–20.
- 28.De Icco R, Greco R, Demartini C, Vergobbi P, Zanaboni A, Tumelero E, et al. Spinal nociceptive sensitization and plasma palmitoylethanolamide levels during experimentally induced migraine attacks. Pain. 2021;162(9):2376–85.
- 29.Li Y, Tatsui CE, Rhines LD, North RY, Harrison DS, Cassidy RM, et al. Dorsal root ganglion neurons become hyperexcitable and increase expression of voltage-gated T-type calcium channels (Cav3.2) in paclitaxel-induced peripheral neuropathy. Pain. 2017;158(3):417–29.
- 30.Odem MA, Bavencoffe AG, Cassidy RM, Lopez ER, Tian J, Dessauer CW, et al. Isolated nociceptors reveal multiple specializations for generating irregular ongoing activity associated with ongoing pain. Pain. 2018;159(11):2347–62.
- 31.Bavencoffe A, Spence EA, Zhu MY, Garza-Carbajal A, Chu KE, Bloom OE, et al. Macrophage migration inhibitory factor (MIF) makes complex contributions to pain-related hyperactivity of nociceptors after spinal cord injury. J Neurosci. 2022;42(27):5463–80.
- 32.Adelman PC, Baumbauer KM, Friedman R, Shah M, Wright M, Young E, et al. Single-cell q-PCR derived expression profiles of identified sensory neurons. Mol Pain. 2019;15:1744806919884496.
- 33.Meerschaert KA, Edwards BS, Epouhe AY, Jefferson B, Friedman R, Babyok OL, et al. Neuronally expressed PDL1, not PD1, suppresses acute nociception. Brain Behav Immun. 2022;106:233–46.
- 34.Basso DM, Fisher LC, Anderson AJ, Jakeman LB, McTigue DM, Popovich PG. Basso mouse scale for locomotion detects differences in recovery after spinal cord injury in five common mouse strains. J Neurotrauma. 2006;23(5):635–59.
- 35.Arevalo-Martin A, Garcia-Ovejero D, Sierra-Palomares Y, Paniagua-Torija B, Gonzalez-Gil I, Ortega-Gutierrez S, et al. Early endogenous activation of CB1 and CB2 receptors after spinal cord injury is a protective response involved in spontaneous recovery. PLoS ONE. 2012;7(11): e49057.
- 36.Garcia-Ovejero D, Arevalo-Martin A, Petrosino S, Docagne F, Hagen C, Bisogno T, et al. The endocannabinoid system is modulated in response to spinal cord injury in rats. Neurobiol Dis. 2009;33(1):57–71.
- 37.Walters ET, Crook RJ, Neely GG, Price TJ, Smith ESJ. Persistent nociceptor hyperactivity as a painful evolutionary adaptation. Trends Neurosci. 2023;46(3):211–27.
- 38.Lemtiri-Chlieh F, Levine ES. BDNF evokes release of endogenous cannabinoids at layer 2/3 inhibitory synapses in the neocortex. J Neurophysiol. 2010;104(4):1923–32.
- 39.Carlton SM, Du J, Tan HY, Nesic O, Hargett GL, Bopp AC, et al. Peripheral and central sensitization in remote spinal cord regions contribute to central neuropathic pain after spinal cord injury. Pain. 2009;147(1–3):265–76.
- 40.Baron R, Hans G, Dickenson AH. Peripheral input and its importance for central sensitization. Ann Neurol. 2013;74(5):630–6.
- 41.Sagar DR, Gaw AG, Okine BN, Woodhams SG, Wong A, Kendall DA, et al. Dynamic regulation of the endocannabinoid system: implications for analgesia. Mol Pain. 2009;5:59.
- 42.Guasti L, Richardson D, Jhaveri M, Eldeeb K, Barrett D, Elphick MR, et al. Minocycline treatment inhibits microglial activation and alters spinal levels of endocannabinoids in a rat model of neuropathic pain. Mol Pain. 2009;5:35.
- 43.Petrosino S, Palazzo E, de Novellis V, Bisogno T, Rossi F, Maione S, et al. Changes in spinal and supraspinal endocannabinoid levels in neuropathic rats. Neuropharmacology. 2007;52(2):415–22.
- 44.Kinsey SG, Long JZ, O’Neal ST, Abdullah RA, Poklis JL, Boger DL, et al. Blockade of endocannabinoid-degrading enzymes attenuates neuropathic pain. J Pharmacol Exp Ther. 2009;330(3):902–10.
- 45.Bryce TN, Biering-Sørensen F, Finnerup NB, Cardenas DD, Defrin R, Lundeberg T, et al. International spinal cord injury pain classification: part I Background and description. Spinal Cord. 2012;50(6):413–7.
- 46.Skaper SD, Facci L, Barbierato M, Zusso M, Bruschetta G, Impellizzeri D, et al. N-palmitoylethanolamine and neuroinflammation: a novel therapeutic strategy of resolution. Mol Neurobiol. 2015;52(2):1034–42.
- 47.Sagar DR, Smith PA, Millns PJ, Smart D, Kendall DA, Chapman V. TRPV1 and CB(1) receptor-mediated effects of the endovanilloid/endocannabinoid N-arachidonoyl-dopamine on primary afferent fibre and spinal cord neuronal responses in the rat. Eur J Neurosci. 2004;20(1):175–84.
- 48.Singh Tahim A, Sántha P, Nagy I. Inflammatory mediators convert anandamide into a potent activator of the vanilloid type 1 transient receptor potential receptor in nociceptive primary sensory neurons. Neuroscience. 2005;136(2):539–48.
- 49.Costigan M, Scholz J, Woolf CJ. Neuropathic pain: a maladaptive response of the nervous system to damage. Annu Rev Neurosci. 2009;32:1–32.
- 50.Zhao W, Ma L, Deng D, Han L, Xu F, Zhang T, et al. BDNF-VGF pathway aggravates incision induced acute postoperative pain via upregulating the neuroinflammation in dorsal root ganglia. Mol Neurobiol. 2024. 10.1007/s12035-024-04249-7.
- 51.Knerlich-Lukoschus F, Noack M, von der Ropp-Brenner B, Lucius R, Mehdorn HM, Held-Feindt J. Spinal cord injuries induce changes in CB1 cannabinoid receptor and C–C chemokine expression in brain areas underlying circuitry of chronic pain conditions. J Neurotrauma. 2011;28(4):619–34.
- 52.Lopez ER, Carbajal AG, Tian JB, Bavencoffe A, Zhu MX, Dessauer CW, et al. Serotonin enhances depolarizing spontaneous fluctuations, excitability, and ongoing activity in isolated rat DRG neurons via 5-HT(4) receptors and cAMP-dependent mechanisms. Neuropharmacology. 2021;184: 108408.
- 53.Wu XS, McNeil BD, Xu J, Fan J, Xue L, Melicoff E, et al. Ca(2+) and calmodulin initiate all forms of endocytosis during depolarization at a nerve terminal. Nat Neurosci. 2009;12(8):1003–10.
- 54.Hefti FF, Rosenthal A, Walicke PA, Wyatt S, Vergara G, Shelton DL, et al. Novel class of pain drugs based on antagonism of NGF. Trends Pharmacol Sci. 2006;27(2):85–91.
- 55.Wei J, Su W, Zhao Y, Wei Z, Hua Y, Xue P, et al. Maresin 1 promotes nerve regeneration and alleviates neuropathic pain after nerve injury. J Neuroinflammation. 2022;19(1):32.
- 56.Evans RM, Scott RH, Ross RA. Chronic exposure of sensory neurones to increased levels of nerve growth factor modulates CB1/TRPV1 receptor crosstalk. Br J Pharmacol. 2007;152(3):404–13.
Associated Data
Supplementary Materials
Data Availability Statement
Data are available upon reasonable request. Please contact the corresponding author.