Conserved age‐related increases in hippocampal PDE11A4 cause unexpected proteinopathies and cognitive decline of social associative memories
Pilarzyk et al.
Department of Pharmacology, Physiology & Neuroscience University of South Carolina School of Medicine Columbia South Carolina USA
Instrument Resource Facility University of South Carolina School of Medicine Columbia South Carolina USA
Department of Anatomy & Neurobiology University of Maryland School of Medicine Baltimore Maryland USA
Center for Research on Aging University of Maryland School of Medicine Baltimore Maryland USA
* CorrespondenceMichy P. Kelly, Department of Anatomy & Neurobiology, Center for Research on Aging, University of Maryland School of Medicine, 20 Penn St, HSFII Rm S216, Baltimore, MD 21201, USA.
Email: michy.kelly@som.umaryland.edu
Abstract
In humans, associative memories are more susceptible to age‐related cognitive decline (ARCD) than are recognition memories. Reduced cAMP/cGMP signaling in the hippocampus may contribute to ARCD. Here, we found that both aging and traumatic brain injury‐associated dementia increased the expression of the cAMP/cGMP‐degrading enzyme phosphodiesterase 11A (PDE11A) in the human hippocampus. Further, age‐related increases in hippocampal PDE11A4 mRNA and protein were conserved in mice, as was the increased vulnerability of associative versus recognition memories to ARCD. Interestingly, mouse PDE11A4 protein in the aged ventral hippocampus (VHIPP) ectopically accumulated in the membrane fraction and filamentous structures we term “ghost axons.” These age‐related increases in expression were driven by reduced exoribonuclease‐mediated degradation of PDE11A mRNA and increased PDE11A4‐pS117/pS124, the latter of which also drove the punctate accumulation of PDE11A4. In contrast, PDE11A4‐pS162 caused dispersal. Importantly, preventing age‐related increases in PDE11 expression via genetic deletion protected mice from ARCD of short‐term and remote long‐term associative memory (aLTM) in the social transmission of food preference assay, albeit at the expense of recent aLTM. Further, mimicking age‐related overexpression of PDE11A4 in CA1 of old KO mice caused aging‐like impairments in CREB function and remote social—but not non‐social—LTMs. RNA sequencing and phosphoproteomic analyses of VHIPP identified cGMP‐PKG—as opposed to cAMP‐PKA—as well as circadian entrainment, glutamatergic/cholinergic synapses, calcium signaling, oxytocin, and retrograde endocannabinoid signaling as mechanisms by which PDE11A deletion protects against ARCD. Together, these data suggest that PDE11A4 proteinopathies acutely impair signaling in the aged brain and contribute to ARCD of social memories.
Graphical
We identify striking ectopic proteinopathies in the hippocampally‐enriched cAMP/cGMP‐degrading enzyme PDE11A4 as a conserved molecular determinant driving age‐related cognitive decline (ARCD) of associative long‐term memories. Mechanistically, these age‐related PDE11A4 proteinopathies are driven by increased translation and altered trafficking triggered by phosphorylation of serines S117 and S124 in the PDE11A4 regulatory domain. RNA and phosphoproteomic analyses identified cGMP‐PKG (as opposed to cAMP‐PKA), circadian entrainment, glutamate/choline, calcium, oxytocin, and retrograde endocannabinoid signaling as pathways by which PDE11A deletion protects against ARCD.
Boxed Text
Article notes
Pilarzyk, K. , Porcher, L. , Capell, W. R. , Burbano, S. D. , Davis, J. , Fisher, J. L. , Gorny, N. , Petrolle, S. , & Kelly, M. P. (2022). Conserved age‐related increases in hippocampal PDE11A4 cause unexpected proteinopathies and cognitive decline of social associative memories. Aging Cell, 21, e13687. 10.1111/acel.13687 PMC957796036073342
Footnote Group
- 2D‐DIGE
- 2‐dimensional difference in gel electrophoresis
- A.U.
- arbitrary units
- A/A
- PDE11A4‐S117A/S124A
- A
- alanine
- AC3
- adenylyl cyclase 3
- ADRD
- Alzheimer’s Disease and related dementias
- aLTM
- associative long‐term memory
- ARCD
- age‐related cognitive decline
- AStr
- amygdalar‐striatal transition area
- C
- cysteine
- cAMP
- 3’,5’‐cyclic adenosine monophosphate
- cGMP
- 3’,5’‐cyclic guanosine monophosphate
- CREB
- cAMP response‐element binding protein
- D/D
- PDE11A4‐S117D/S124D
- D
- aspartate
- dCA1
- dorsal CA1
- DHIPP
- dorsal hippocampus
- Fc
- fold change
- GFAP
- glial fibrillary acidic protein
- GFP
- emerald green fluorescent protein
- hPDE11A4
- human PDE11A4
- IBA‐1
- ionized calcium binding adaptor molecule 1
- IF
- immunofluorescence
- IHC
- immunohistochemistry
- KO‐O
- old knockout
- KO‐Y
- young knockout
- MAP2
- microtubule associated protein
- MBP
- myelin basic protein
- MDD
- major depressive disorder
- mPDE11A4
- mouse PDE11A
- MS
- mass spectroscopy
- NF‐L
- neurofilament light chain
- NSOR
- non‐social odor recognition memory
- PDE
- 3’,5’‐cyclic nucleotide phosphodiesterase
- PKA
- protein kinase A
- PKG
- protein kinase G
- PS
- Ponceau stain
- r.o.d.
- relative optical density
- rLTM
- recognition long‐term memory
- S117
- PDE11A4 serine 117
- S124
- PDE11A4 serine 124
- S162
- PDE11A4 serine162
- SOR
- social odor recognition memory
- STFP
- social transmission of food preference
- TBI
- traumatic brain injury
- vCA1
- ventral CA1
- VHIPP
- ventral hippocampus
- vSub
- ventral subiculum
- WT‐O
- old wild‐type
- WT‐Y
- young wild‐type
- Y
- tyrosine
1INTRODUCTION
After the age of 60, nearly all individuals experience some form of cognitive decline—particularly memory deficits—and no drugs prevent or reverse this loss (Abbott, 2012; Kelly, 2017). Even in the absence of dementia, age‐related cognitive decline (ARCD) increases healthcare costs and risk for disability (Plassman et al., 2008). ARCD is not a uniform process, with variability in symptom severity observed across individuals and cognitive domains (Abbott, 2012). For example, associative memories are more susceptible to ARCD in humans than are recognition memories (Bender et al., 2010; Bridger et al., 2017; Hargis & Castel, 2017; Hartman & Warren, 2005; Old & Naveh‐Benjamin, 2008; Overman & Becker, 2009; Troyer et al., 2011) for reasons that are not clear but may be related to deficient activation of anterior hippocampus (Dalton et al., 2013; Nordin et al., 2017) (a.k.a. ventral hippocampal formation in rodents, VHIPP). This lack of knowledge slows therapeutic development.
3′,5′‐cyclic adenosine monophosphate (cAMP) and 3′,5′‐cyclic guanosine monophosphate (cGMP) signaling are decreased in the aged and demented hippocampus (rodents and humans), particularly when there is a history of traumatic brain injury (TBI) (Bonkale et al., 1999; Titus et al., 2013; Zhang et al., 2014). Interestingly, cyclic nucleotide signaling deficits associated with neuropsychiatric and age‐related diseases of the brain can be more prominent in one subcellular compartment versus another (Bonkale et al., 1995; Bonkale et al., 1999; Chang et al., 2003; Fields et al., 1999; Kelly, 2018a; Rahman et al., 1997). Together, these findings suggest that select enzymes that generate (i.e., cyclases) and/or break down cAMP and cGMP (i.e., 3′,5′‐cyclic nucleotide phosphodiesterases, PDEs) not only change in expression and/or activity, but may also become ectopically localized (Houslay, 2010; Kokkonen & Kass, 2017). Such an ectopic localization could prove exceptionally deleterious since the discrete localization of these enzymes within specific subcellular domains allows a single cell to recognize and respond uniquely to multiple stimuli (Houslay, 2010; Kokkonen & Kass, 2017). In other words, where a cyclase or PDE is localized is just as important to its overall function as is its catalytic activity (Baillie et al., 2019).
Age‐related changes in cyclic nucleotide signaling may worsen cognition by promoting proteinopathies (a.k.a. proteopathies)—abnormalities in protein synthesis, post‐translational modification, folding, or deposition that occur with normal aging and age‐related diseases (Jo et al., 2020; Karanth et al., 2020; Moreno‐Gonzalez & Soto, 2011; Yanar et al., 2020). For example, reductions in hippocampal adenylyl cyclase correlate with the accumulation of amyloid plaques (Ohm et al., 1991), and increasing cyclic nucleotide signaling through the cAMP‐PKA and cGMP‐PKG pathways helps clear aggregated proteins that cause neurodegeneration (Goldberg et al., 2021; VerPlank et al., 2020; VerPlank & Goldberg, 2017). On the contrary, aberrant phosphorylation driven by cAMP/cGMP‐regulated kinases can drive the accumulation of tau and TDP‐43 in many neurodegenerative diseases (Gao et al., 2018; Moloney et al., 2021). Therefore, it is of great interest to determine how the dysregulation of cyclic nucleotides within specific brain regions and subcellular compartments may drive proteinopathies associated with aging and how that dysregulation may affect ARCD.
The age‐related decreases in hippocampal cyclic nucleotides described above are consistent with our observation that expression of PDE11A4 increases with age in both the mouse and rat hippocampus (Hegde, Capell, et al., 2016; Kelly et al., 2014). The PDE11A family is comprised of a single gene that is spliced into 4 isoforms, PDE11A1–4. The longest isoform, PDE11A4, is the isoform that is expressed in brain and is ~95% homologous across mouse, rat, and human (Yuasa, Kanoh, et al., 2001; Yuasa, Ohgaru, et al., 2001). All 4 isoforms are considered dual‐specific, in that they degrade both cAMP and cGMP; however, enzyme assays suggest PDE11A4 may hydrolyze cAMP with a higher K m and V max than cGMP (Weeks et al., 2005; Yuasa et al., 2000). PDE11A single nucleotide polymorphisms are associated with major depressive disorder (MDD) (Cabanero et al., 2009; Luo et al., 2009; Wong et al., 2006), suicide risk (Coon et al., 2013), sleep quality (Jones et al., 2019), antidepressant response in patients with MDD (Luo et al., 2009; Wong et al., 2006) (but see (Cabanero et al., 2009; Perlis et al., 2010)), and lithium response in patients with bipolar disorder (Couzin, 2008; Kelsoe, 2010; Mertens et al., 2015). It is, then, interesting to note that both MDD and BPD have been conceptualized as diseases of accelerated aging (Kinser & Lyon, 2013; Rizzo et al., 2014). PDE11A4 mRNA is strongly expressed in neurons of CA1, the subiculum, and the adjacently connected amygdalohippocampal area of the VHIPP (Hegde, Capell, et al., 2016; Kelly et al., 2010), with moderate expression in dorsal hippocampus (DHIPP) and little to no expression in other brain regions (Hegde, Capell, et al., 2016; Jäger et al., 2012; Kelly, 2015; Kelly et al., 2010; Pathak et al., 2017). Thus, PDE11A4 molecularly defines an exceptionally discrete neuronal population within a brain region key to associative memory, making it ripe for study in the context of ARCD.
Consistent with its enrichment in the VHIPP, PDE11A4 regulates preferences for social interactions as well as the consolidation of social memories (Hegde, Capell, et al., 2016; Hegde, Ji, et al., 2016; Kelly et al., 2010; Pilarzyk et al., 2019; Smith et al., 2021). The effect of PDE11A deletion on social memory in young adult mice is quite unique in that it triggers a transient amnesia that ultimately produces a stronger remote long‐term memory (LTM; i.e., intact short‐term memory, impaired recent LTM, improved remote LTM) (Pilarzyk et al., 2019). Further, we have shown PDE11A regulates signals important for social memory consolidation, including oxytocin signaling, glutamatergic signaling, calcium/calmodulin‐dependent kinase II signaling, CREB function, and protein synthesis (Hegde, Capell, et al., 2016; Kelly et al., 2010; Kelly et al., 2014; Pilarzyk et al., 2021; Smith et al., 2021). As such, here we test the hypothesis that age‐related increases in hippocampal PDE11A4 are conserved across species, occur in an ectopic subcellular compartment, and impair social associative memories.
2RESULTS
2.1Age‐related increases in PDE11A mRNA are conserved
We previously showed that PDE11A4 mRNA and protein expression in the hippocampus increase across the lifespan in rodents (Hegde, Capell, et al., 2016; Kelly et al., 2014). Here, we assessed age‐related changes in expression in human HIPP by mining data from the Allen Institute for Brain Sciences Brainspan database. As in rodents, hippocampal PDE11A mRNA expression in humans increased across the lifespan (Figure 1a). The large 2.66‐fold increase in expression between the prenatal and adulthood period (18–44 years of age) is unique to PDE11A, as PDE5A—the closest related PDE—shows no such increase in hippocampus (Figure 1b). Further, our previous work on the next closest‐related PDEs shows only a modest 0.36‐fold increase in PDE2A mRNA along with a 0.42‐fold and 0.54‐fold decrease in PDE9A and PDE10A mRNA, respectively (Farmer et al., 2020; Patel et al., 2018). Next, we determined if this age‐related increase in PDE11A mRNA expression might be related to increased transcript stability by examining expression of p54nrb/NONO and the exoribonuclease XRN2, both of which form a complex with PDE11A4 mRNA to target it for degradation (Lu & Sewer, 2015). In concert with the age‐related increases in PDE11A mRNA expression, we see that p54nrb/NONO and XRN2 mRNA decrease (Figure 1c–d). Given evidence that TBI can exacerbate age‐related decreases in hippocampal cAMP levels (Titus et al., 2013), we next mined data from the Aging, Dementia, and Traumatic Brain Injury database that includes data from a group of 75+‐year‐old patients characterized with regard to their history of TBI and dementia. Among elderly humans with a history of TBI, hippocampal PDE11A mRNA expression was significantly higher in those that developed dementia versus those that did not (Figure 1e). In contrast, there was no difference between TBI patients with vs. without dementia in terms of PDE2A (−dementia, 0.95 ± 0.04; +dementia 0.90 ± 0.03), PDE5A (−dementia, 0.96 ± 0.02; +dementia, 0.97 ± 0.03), or PDE10A expression (−dementia, 0.83 ± 0.03; +dementia 0.86 ± 0.04). Together, these data suggest that PDE11A expression uniquely increases with age in the human hippocampus in part due to increases in transcript stability, and that these age‐related increases can be exacerbated in those with dementia and a history of TBI.
2.2Age‐related increases in PDE11A4 protein expression occur in a compartment‐specific manner
As noted above, PDEs are discretely localized to specific brain regions and subcellular domains (Houslay, 2010; Kokkonen & Kass, 2017). At the regional level, PDE11A4 mRNA is restricted to the extended hippocampal formation, with enrichment in VHIPP versus DHIPP. At the subcellular level, PDE11A4 is enriched in the cytosol vs. membrane and nucleus, which stands in contrast to PDE2A and PDE10A—the two most closely related PDEs expressed in hippocampus—both of which are greatly enriched in the membrane versus cytosol (Kelly, 2018b). As such, we determined if age‐related increases in PDE11A4 were uniformly distributed or were restricted to discrete, potentially ectopic, compartments. In situ hybridization shows that PDE11A4 mRNA in the middle‐aged mouse brain remains largely restricted to the extended hippocampal formation (Figure 1f), including CA1, subiculum, the AHi, and—in a subset of male and female mice—the amygdalar‐striatal transition area (AStr) that sits just anterior to the hippocampus (Figure 1h). Note that expression in the AStr had not been noted with previous weaker probes (Hegde, Capell, et al., 2016; Kelly et al., 2010; Kelly et al., 2014). In DHIPP, there was no effect of age on PDE11A4 mRNA expression (Figure 1i); however, protein expression was increased in the nuclear and cytosolic compartments of old versus young mice (Figure 1k; see Figure S1A for validation of biochemical fractionations). In contrast, select subfields of the VHIPP did show increased PDE11A mRNA expression in middle‐aged versus young mice (i.e., the superficial and deep subfields within distal CA1 and the ventral subiculum; Figure 1j), and PDE11A4 protein was increased only in the membrane compartment of old versus young mice (Figure 1l). Native gels suggest that PDE11A4 is not associated with the membrane directly (e.g., via palmitoylation), but rather via protein–protein interactions (Figure S1B). Phosphorylation is a post‐translational modification known to alter PDE protein–protein interactions (Baillie et al., 2019). As such, we validated antibodies that recognize phosphorylation of PDE11A4 serines 117 and 124 (Figure S1C). Immunofluorescence with antibodies that detect all PDE11A4 (Figure 1m, n), PDE11A4‐pS117 (not shown but see Source Data), or PDE11A4‐pS117/pS124 (Figure 1m, n; see Figure S1 for antibody validation) confirmed the differential compartment‐specific localizations of PDE11A4 protein in the aged DHIPP versus VHIPP, with PDE11A4 in VHIPP accumulating in filamentous structures that are rarely seen in young C57BL/6J mice (Figure 1o, p). This increased accumulation of PDE11A4 in the aged VHIPP is also observed in BALB/cJ (Figure S2A, C) and 129S6/SvEv mice (Figure S2D). We term these PDE11A4‐filled structures ghost axons (see Figure 2) and find they are enriched for PDE11A4 that is phosphorylated at serine 117 and 124 (pS117/pS124; Figure 1m bottom and 1n). This age‐related increase in PDE11A4‐pS117/pS124‐filled structures may be deleterious since associative memory consolidation in the social transmission of food preference assay—but not memory retrieval—normally triggers a reduction in their presence (Figure 1q).
2.3Preventing age‐related increases in PDE11A is sufficient to prevent cognitive decline of social associative memory
Human studies show that associative memories involving verbal and/or non‐verbal stimuli (e.g., faces and names) are more susceptible to age‐related cognitive decline than are recognition memories for individual items (Bender et al., 2010; Bridger et al., 2017; Hargis & Castel, 2017; Hartman & Warren, 2005; Old & Naveh‐Benjamin, 2008; Overman & Becker, 2009; Troyer et al., 2011). We were able to recapitulate a differential sensitivity of aLTMs vs recognition LTMs (rLTMs) in C57BL/6J mice using social memory tasks (Figure S4). To test the hypothesis that ARCD of aLTMs is driven by the age‐related increases in PDE11A4 expression described above, we compared male and female young vs. old Pde11a WT and KO mice in social transmission of food preference (STFP). [Note that female Pde11a WT and KO mice are indistinguishable in terms of cycle length or reproductive senescence (Figure S5), consistent with our previous report showing no gross peripheral pathology in middle‐aged KO mice (Kelly et al., 2010).] Our initial focus on social aLTM stems from the fact that in young adult mice, PDE11A4 regulates social behaviors and social memory, but not non‐social memory (Hegde, Capell, et al., 2016; Hegde, Ji, et al., 2016; Kelly et al., 2010; Pilarzyk et al., 2019; Smith et al., 2021). To assess the specificity of effects for aLTMs, we also tested these mice for social odor recognition memory (SOR) and non‐social odor recognition memory (NSOR). In all assays, we tested short‐term memory (STM), recent LTM 24 h after training, and remote LTM 7 days after training given that we previously showed deletion of PDE11A produces transient amnesia for social memories in adolescent and young adult mice (e.g., intact STM, impaired recent LTM, and intact/improved remote LTM). Old Pde11a WT mice exhibited STM for STFP but it was weaker than that of young WT mice (Figure 3a, Figure S6A; Table 1). This deficit worsened as time progressed with old WT mice failing to demonstrate any aLTM for STFP at the 24‐h and 7‐day timepoints (Figure 3b, c, Figure S6B, C). Despite the fact that both young and old Pde11a KO mice demonstrate a transient amnesia for recent aLTM 24 hours after STFP training (Figure 3b, Figure S6B), old KO mice show stronger STM and remote aLTM 7 days after STFP training relative to old WT mice (Figure 3a, c, Figure S6A–C). Middle‐aged Pde11a HT and KO mice similarly show enhanced remote aLTM relative to middle‐aged WT mice 7 days after STFP training (Figure S6F), despite middle‐aged KO mice exhibiting no recent aLTM (Figure S6B). Consistent with our observations in the C57BL/6J mice (Figure S4), there was no ARCD of SOR or NSOR in any genotype at any time point; however, both young and old Pde11a KO mice exhibited a transient amnesia for SOR in line with our previous work in young mice (Figure 3d–f) (Pilarzyk et al., 2019). Importantly, the effect of genotype on these memory tasks cannot be explained by performance aspects of these assays. Although old mice consistently ate less food during STFP and spent less time investigating during SOR than young mice, and females ate more food during STFP and spent more time investigating during SOR than males as we previously described (Pilarzyk et al., 2019), there were no main effects or interactions with the effect of genotype (Table S1). This suggests the effects of age and genotype on memory versus food consumption and total time investigating social odors are dissociable. Thus, old Pde11a KO mice exhibit transient amnesia for social but not non‐social memories much like young KO mice, and the ability of Pde11a deletion to prevent ARCD of STFP aLTMs is related to the associative nature of the memory as opposed to age‐related changes in recognizing the social or non‐social components.
| Datasets | WT‐Y | WT‐O | KO‐Y | KO‐O |
|---|---|---|---|---|
| Figure 3a food STFP STM | t(22) = 7.29, FDR‐p < 0.001 | t(19) = 2.84, FDR‐p = 0.011 | t(23) = 6.81, FDR‐p < 0.001 | t(17) = 4.29, FDR‐p < 0.001 |
| Figure 3a time STFP STM | t(22) = 7.42, FDR‐p < 0.001 | t(19) = 3.63, FDR‐p = 0.002 | t(23) = 9.38, FDR‐p < 0.001 | t(17) = 5.92, FDR‐p < 0.001 |
| Figure 3b food STFP 24 h LTM | t(14) = 3.48, FDR‐p = 0.015 | t(20) = 1.97, FDR‐p = 0.126 | t(13) = 0.57, FDR‐p = 0.574 | t(19) = 1.09, p = 0.388 |
| Figure 3b time STFP 24 h LTM | t(14) = 4.51, FDR‐p = 0.002 | t(20) = 1.72, FDR‐p = 0.135 | t(13) = 0.49, FDR‐p = 0.635 | t(17) = 2.45, FDR‐p = 0.051 |
| Figure 3c food STFP 7 d LTM | t(25) = 9.35, FDR‐p < 0.001 | t(23) = 1.93, FDR‐p = 0.066 | t(27) = 8.44, FDR‐p < 0.001 | t(25) = 5.66, FDR‐p < 0.001 |
| Figure 3c time STFP 7 d LTM | t(25) = 11.12, FDR‐p < 0.001 | t(24) = 1.46, FDR‐p = 0.157 | t(26) = 8.53, FDR‐p < 0.001 | t(24) = 8.7, FDR‐p < 0.001 |
| Figure 3d SOR STM | t(14) = 8.12, FDR‐p < 0.001 | t(14) = 8.11, FDR‐p < 0.001 | t(13) = 7.60, p < 0.001 | t(14) = 6.09, FDR‐p < 0.001 |
| Figure 3e SOR 24 h LTM | t(8) = 6.06, FDR‐p = 0.001 | t(11) = 4.66, FDR‐p = 0.001 | t(8) = 4.23, FDR‐p = 0.004 | t(11) = 1.72, FDR‐p = 0.113 |
| Figure 3f SOR 7 d LTM | t(18) = 3.19, FDR‐p = 0.007 | t(17) = 2.44, FDR‐p = 0.026 | t(19) = 7.46, FDR‐p < 0.001 | t(17) = 5.33, FDR‐p < 0.001 |
| Figure 3g NSOR STM | t(5) = 8.06, FDR‐p < 0.001 | t(5) = 14.83, FDR‐p < 0.001 | t(5) = 5.64, p < 0.001 | t(5) = 10.53, FDR‐p < 0.001 |
| Figure 3h NSOR 24 h LTM | t(8) = 10.57, FDR‐p < 0.001 | t(14) = 9.25, FDR‐p < 0.001 | t(8) = 7.43, p < 0.001 | t(14) = 10.58, FDR‐p < 0.001 |
| Figure 3i NSOR 7 d LTM | t(15) = 7.39, FDR‐p < 0.001 | t(14) = 2.68, FDR‐p = 0.018 | t(15) = 3.66, p = 0.003 | t(21) = 6.38, FDR‐p < 0.001 |
| Figure S7C SOR 7 d LTM retest | t(22) = 4.03, FDR‐p < 0.001 | t(28) = 6.13, FDR‐p < 0.001 | t(22) = 4.27, FDR‐p < 0.001 | t(27) = 6.25, FDR‐p < 0.001 |
| KO‐GFP‐PDE11A4 | KO‐GFP | |||
| Figure 3k STFP 7 d LTM | t(6) = 1.13, p = 0.301 | t(4) = 3.61, FDR‐p = 0.044 | ||
| Figure 3l SOR 7 d LTM | t(20) = 1.38, p = 0.183 | t(19) = 7.73, FDR‐p < 0.001 | ||
| Figure 3m NSOR 7 d LTM | t(18) = 10.32, FDR‐p < 0.001 | t(16) = 8.58, FDR‐p < 0.001 | ||
| Young | Old | |||
| Figure S4A C57 food STFP 7 d LTM | t(22) = 385; FDR‐p = 0.012 | t(22) = −0.28; FDR‐p = 0.781 | ||
| Figure S4B C57 SOR 7 d LTM | t(21) = 3.94, FDR‐p < 0.001 | t(22) = 2.64, FDR‐p = 0.015 | ||
| Figure S4C C57 NSOR 7 d LTM | t(13) = 8.21, FDR‐p < 0.001 | t(13) = 8.02, FDR‐p < 0.001 | ||
| WT‐MA | HT‐MA | KO‐MA | ||
| Figure S6A food STFP STM | t(12) = 2.71, FDR‐p = 0.028 | t(7) = 0.62, FDR‐p = 0.554 | t(14) = 8.77, FDR‐p < 0.001 | |
| Figure S6A time STFP STM | t(12) = 2.70, FDR‐p = 0.029 | t(7) = 0.49, FDR‐p = 0.638 | t(14) = 9.57, FDR‐p < 0.001 | |
| Figure S6B food STFP 24 h LTM | t(14) = 4.42, FDR‐p = 0.002 | t(7) = 1.57, FDR‐p = 0.241 | t(14) = 1.24, FDR‐p = 0.237 | |
| Figure S6B time STFP 24 h LTM | t(14) = 6.27, FDR‐p < 0.001 | t(7) = 2.19, FDR‐p = 0.097 | t(14) = 1.36, FDR‐p = 0.194 | |
| Figure S6C food 7 d LTM | t(13) = −1.93, FDR‐p = 0.113 | t(6) = 1.54, FDR‐p = 0.17 | t(14) = 4.49, FDR‐p = 0.002 | |
| Figure S6C time 7 d LTM | t(13) = –1.72, FDR‐p = 0.164 | t(6) = 0.82, FDR‐p = 0.445 | t(14) = 5.58 FDR‐p < 0.001 |
2.5RNA sequencing and phosphoproteomics of the VHIPP implicate many of the same pathways in the protective effect of PDE11A deletion
To gain insight into how the absence of PDE11A4 in the adult hippocampus provides protection against ARCD, we conducted an RNA sequencing study in one cohort of mice followed by a confirmatory phosphoproteomic study in a second cohort of mice using VHIPP samples from aged Pde11a KO and WT mice. Importantly, changes in gene expression and protein phosphorylation were enriched in many of the same pathways (Table 2). Consistent with PDE11A4 regulating cyclic nucleotide signaling and social behaviors, both studies identified the cGMP‐PKG signaling pathway and oxytocin signaling pathway. Interestingly, both studies also identified the calcium signaling, glutamatergic synapse, cholinergic synapse, and Alzheimer's disease pathways, all of which have been implicated in ARCD and/or dementia (see Discussion). Given the age‐related accumulation of PDE11A4 in ghost axons, it is also interesting to note that both studies identified pathways related to the axon and axon guidance, regulation of transport, chemical synaptic transmission, as well as the synapse, presynapse, and synaptic vesicle. An effect of PDE11A deletion on these latter pathways is consistent with PDE11A4 colocalizing with adaptin, a marker of intracellular transport vesicles (Figure S9C). Additional age‐related pathways of note that were identified by one technique but not the other included longevity regulating pathway (RNA sequencing, strength 0.46, FDR‐p = 0.001), longevity regulating pathway‐multiple species (RNA sequencing, strength 0.55, FDR‐p < 0.001) and cellular senescence (phosphoproteomics, strength 1.25, FDR‐p = 0.008).
| #Term ID | Term description | Background gene count | RNA sequencing pathway analyses results | Phosphoproteomics pathway analyses | ||||
|---|---|---|---|---|---|---|---|---|
| observed gene count | strength | FDR‐p | observed gene count | strength | FDR‐p | |||
| KEGG Pathways | ||||||||
| mmu04020 | Calcium signaling pathway | 180 | 37 | 0.45 | 9.17E−06 | 4 | 1.35 | 0.001 |
| mmu04723 | Retrograde endocannabinoid signaling | 145 | 26 | 0.39 | 0.00097 | 4 | 1.44 | 0.001 |
| mmu04724 | Glutamatergic synapse | 113 | 23 | 0.45 | 0.00067 | 3 | 1.42 | 0.0035 |
| mmu04921 | Oxytocin signaling pathway | 149 | 20 | 0.27 | 0.049 | 3 | 1.3 | 0.0067 |
| mmu04022 | cGMP−PKG signaling pathway | 164 | 32 | 0.43 | 7.29E−05 | 3 | 1.26 | 0.0079 |
| mmu05010 | Alzheimer's disease | 167 | 22 | 0.26 | 0.0454 | 3 | 1.26 | 0.0079 |
| mmu04971 | Gastric acid secretion | 72 | 12 | 0.36 | 0.049 | 2 | 1.44 | 0.0169 |
| mmu04727 | GABAergic synapse | 87 | 19 | 0.48 | 0.00097 | 2 | 1.36 | 0.0211 |
| mmu05032 | Morphine addiction | 91 | 26 | 0.6 | 4.95E−06 | 2 | 1.34 | 0.0219 |
| mmu04713 | Circadian entrainment | 95 | 26 | 0.58 | 7.62E−06 | 2 | 1.32 | 0.0227 |
| mmu04725 | Cholinergic synapse | 112 | 24 | 0.47 | 0.00025 | 2 | 1.25 | 0.0241 |
| mmu05225 | Hepatocellular carcinoma | 168 | 23 | 0.28 | 0.0285 | 2 | 1.08 | 0.0382 |
| mmu04360 | Axon guidance | 174 | 33 | 0.42 | 7.65E−05 | 2 | 1.06 | 0.0395 |
| GO Processes | ||||||||
| GO:0050896 | Response to stimulus | 6616 | 664 | 0.14 | 7.61E−19 | 17 | 0.41 | 0.0034 |
| GO:0010243 | Response to organonitrogen compound | 867 | 105 | 0.22 | 3.86E−05 | 7 | 0.91 | 0.0052 |
| GO:0006950 | Response to stress | 2899 | 248 | 0.07 | 0.043 | 11 | 0.58 | 0.0072 |
| GO:0051049 | Regulation of transport | 1782 | 202 | 0.19 | 9.30E−08 | 9 | 0.7 | 0.0072 |
| GO:0009987 | Cellular process | 12459 | 1138 | 0.1 | 6.33E−29 | 21 | 0.23 | 0.0093 |
| GO:0072347 | Response to anesthetic | 81 | 14 | 0.38 | 0.0441 | 3 | 1.57 | 0.01 |
| GO:0010035 | Response to inorganic substance | 505 | 61 | 0.22 | 0.0035 | 5 | 1 | 0.0118 |
| GO:0043279 | Response to alkaloid | 115 | 18 | 0.33 | 0.0376 | 3 | 1.42 | 0.0182 |
| GO:0007268 | Chemical synaptic transmission | 321 | 55 | 0.37 | 2.54E−06 | 4 | 1.1 | 0.0183 |
| GO:0010038 | Response to metal ion | 344 | 42 | 0.23 | 0.0193 | 4 | 1.07 | 0.0183 |
| GO:0032501 | Multicellular organismal process | 5888 | 643 | 0.18 | 6.03E−27 | 14 | 0.38 | 0.0183 |
| GO:0042493 | Response to drug | 926 | 114 | 0.23 | 8.11E−06 | 6 | 0.81 | 0.0183 |
| GO:0051128 | Regulation of cellular component organization | 2337 | 272 | 0.21 | 7.00E−12 | 9 | 0.59 | 0.0183 |
| GO Component | ||||||||
| GO:0120025 | Plasma membrane bounded cell projection | 2172 | 273 | 0.24 | 1.22E−15 | 12 | 0.74 | 2.11E−05 |
| GO:0043005 | Neuron projection | 1429 | 207 | 0.3 | 4.05E−17 | 10 | 0.85 | 2.11E−05 |
| GO:0005737 | Cytoplasm | 9909 | 858 | 0.08 | 3.08E−10 | 21 | 0.33 | 2.54E−05 |
| GO:0008021 | Synaptic vesicle | 183 | 24 | 0.26 | 0.0465 | 5 | 1.44 | 3.27E−05 |
| GO:0045202 | Synapse | 968 | 150 | 0.33 | 2.44E−14 | 8 | 0.92 | 6.43E−05 |
| GO:0005622 | Intracellular | 12,462 | 1099 | 0.09 | 6.33E−20 | 22 | 0.25 | 7.08E−05 |
| GO:0030425 | Dendrite | 694 | 117 | 0.37 | 2.56E−13 | 7 | 1 | 7.08E−05 |
| GO:0098793 | Presynapse | 429 | 60 | 0.29 | 9.86E−05 | 6 | 1.15 | 7.08E−05 |
| GO:0032991 | Protein−containing complex | 4701 | 479 | 0.15 | 2.56E−13 | 14 | 0.47 | 0.00023 |
| GO:0005829 | Cytosol | 3326 | 283 | 0.07 | 0.0249 | 12 | 0.56 | 0.00023 |
| GO:0098796 | Membrane protein complex | 1009 | 119 | 0.21 | 1.56E−05 | 7 | 0.84 | 0.00035 |
| GO:0005623 | Cell | 14,044 | 1233 | 0.08 | 1.32E−26 | 22 | 0.2 | 0.00041 |
| GO:0030424 | Axon | 712 | 123 | 0.38 | 1.48E−14 | 6 | 0.93 | 0.00044 |
2.6Phosphorylation of serine 117 (S117) and serine 124 (S124), but not serine 162 (S162), are sufficient to increase PDE11A4 expression and drive PDE11A4 accumulation
Previous studies have suggested PDE11A4 regulates its own protein expression levels (Hegde, Ji, et al., 2016; Smith et al., 2021). As such we determined if the increased phosphorylation of PDE11A4 at S117 and S124 observed in the aged hippocampus (Figure 1k–n and Figure S2) was sufficient to cause aging‐like increases in PDE11A4 protein expression and accumulation. To do so, we tested the effect of phosphoresistant (alanine) versus phosphomimic mutations (aspartate, D) at these sites in vitro. We also assessed the specificity of these signals by similarly targeting S162, as it is also a PKA/PKG‐regulated serine in the N‐terminal of PDE11A4 (Kelly, 2015; Kelly, 2018b). Across multiple experiments and cell lines (i.e., COS‐1 and HT‐22), preventing phosphorylation at S117/S124 or S124 alone was sufficient to decrease PDE11A4 protein expression while mimicking phosphorylation at S117/S124 or S124 alone increased expression (Figure 4a–c).
As is observed in the aging brain, mouse and human PDE11A4 accumulates in punctate structures in vitro and PDE11A4‐pS117 is preferentially found in these puncta (Figure 4d–e). As such, we next determined if preventing/mimicking phosphorylation at S117 and S124 would be sufficient to reduce/increase trafficking of mPDE11A4 into puncta. Although S117A alone had no effect, both S124A and S117A/S124A reduced the presence of PDE11A4‐filled puncta in COS‐1, HEK293T and HT‐22 cells (Figure 4h–j). In contrast, S117D and S124D alone or in combination increased the presence of PDE11A4‐filled puncta in COS‐1 and HEK293T cells (Figure 4k–l); however, only S117D/S124D in combination was sufficient to increase puncta in HT‐22 cells (Figure 4m). The ability of phosphorylation to increase the accumulation of PDE11A4 in puncta appears to be selective for S117 and S124 in that a phosphomimic mutation at S162 (i.e., S162D) had the opposite effect of reducing the accumulation of PDE11A4 in COS‐1, HEK293T, and HT‐22 cells (Figure 4n–p). In COS‐1 and HT‐22 cells, the ability of S117A/S124A to reduce the presence of PDE11A4‐filled puncta does not require phosphorylation of S162 (Figure 4q); however, a phosphomimic mutation of S162 is able to prevent S117D/S124D‐induced accumulation of PDE11A4 (Figure 4s–t). Together, these data suggest that pS117/pS124 is a key molecular mechanism by which PDE11A4 expression and accumulation increase with age.
3DISCUSSION
Here, we show that age‐related increases in hippocampal PDE11A4—but not PDE5A—are conserved across humans and rodents, as is the vulnerability of associative memories—but not recognition memories—to ARCD. Our work is consistent with previous studies showing cGMP and cAMP are decreased in the aged and demented hippocampus (rodents and humans), particularly when there is a history of TBI (Bonkale et al., 1999; Titus et al., 2013; Zhang et al., 2014). Age‐related increases in PDE11A4 appear to be driven by factors influencing both transcript and protein stability, with age‐related increases in PDE11A4 protein expression occurring in a subcellular compartment‐specific manner. Strikingly, age‐related increases in PDE11A4 in the VHIPP ectopically accumulate in filamentous structures we term ghost axons due to increased phosphorylation of PDE11A4 at S117/S124 (PDE11A4pS117/pS124; Figures 1m, n and 4a–c), reminiscent of proteinopathies caused by hyperphosphorylation of tau (c.f., Kelly, 2018a). This age‐related increase in PDE11A4‐pS117/pS124 is thought to be deleterious since STFP memory consolidation is normally associated with reduced levels (Figure 1q). Indeed, we show here that preventing age‐related increases in PDE11A via genetic deletion is sufficient to protect against ARCD of social associative memories, while mimicking age‐related overexpression of PDE11A4 in CA1 of old Pde11a KO mice is sufficient to cause aging‐like impairments in memory (Figure 3k) and CREB function (Figure 3n). This suggests the protective effect of PDE11A deletion in old mice is due to the absence of PDE11A4 signaling in the aged brain and a subsequent increase in VHIPP CREB activity (Smith et al., 2021), as opposed to a compensatory mechanism triggered by the chronic loss of PDE11A across the lifespan (Figure 3k–m). Notably, all of these age‐related effects appear to be relatively consistent between females (data points plotted in figures as circles) and males (data points plotted in figures as squares). RNA sequencing and phosphoproteomics analysis of the VHIPP from old Pde11a KO versus WT mice suggest PDE11A4 overexpression contributes to ARCD of social memories primarily via the cGMP‐PKG pathway as opposed to the cAMP‐PKA pathway and confirm downstream effects on multiple pathways associated with ARCD and Alzheimer's disease (Table 2). Together, these results suggest that increases in PDE11A expression that occur with age and TBI‐associated dementia contribute to cognitive decline.
3.5Conclusions
In summary, proteinopathies in PDE11A4 develop with age, and age‐related increases in PDE11A4 expression that are conserved across species are sufficient to cause ARCD of social associative memories. PDE11A4 is unique because in brain it is the only PDE to be expressed preferentially in the hippocampal formation, a structure critical for associative memories (Kelly et al., 2010; Kelly et al., 2014). This—along with the fact that PDE11A is a highly druggable enzyme (Kelly, 2015)—makes PDE11A a very attractive therapeutic target because it stands to selectively restore aberrant cyclic nucleotide signaling in a brain region affected by age‐related decline without directly affecting signaling in other brain regions or peripheral organs that might lead to unwanted side effects (Kelly, 2015). By gaining a further understanding of the intramolecular signals controlling PDE11A4 subcellular localization (e.g., N‐terminal phosphorylation, homodimerization), we hope to develop even more sophisticated therapeutics that can target disease‐specific PDE11A4 proteinopathies.
4EXPERIMENTAL PROCEDURES
4.1Mouse subjects
Mating trios (1 male × 2 females) of C57BL/6J and BALB/cJ mice were originally obtained from Jackson laboratory and then bred onsite either at the University of South Carolina School of Medicine or the University of Maryland School of Medicine. Old 129S6/SvEv were originally obtained from Taconic at approximately 2 months of age and were then aged onsite at the University of South Carolina School of Medicine, with young mice ordered from Taconic 2 weeks prior to tissue harvest for comparison. As previously published (e.g., Kelly et al., 2010; Pilarzyk et al., 2019; Smith et al., 2021), the Pde11a mouse line was originally obtained from Deltagen (San Mateo, CA) and then maintained on a mixed C57BL6 background (99.8% multiple C57BL/6 substrains and 0.2% 129P2/OlaHsd; Smith et al., 2021) as well as a 98.8% BALB/cJ background (Smith et al., 2021). Note that knockouts on the BALB/cJ background were only used as negative controls in immunofluorescent staining experiments using PDE11A antibodies; no behavior was conducted in the BALB/cJ line. See figure legends for specific n's/sex/group/experiment. For experiments herein, young was defined as 2–6 months old, middle aged was defined as 10–15 months, and old was defined as 18–22 months. Animals were housed on a 12:12 light:dark cycle (experiments conducted during lights on) and allowed ad lib access to food and water, except when undergoing STFP. Experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (Pub 85–23, revised 1996) and were fully approved by the Institutional Animal Care and Use Committee of the University of South Carolina and the University of Maryland, Baltimore. For more detailed information, see the Appendix S1.
4.2Assays
Studies were largely conducted as per previously published methods (Farmer et al., 2020; Hegde, Capell, et al., 2016; Hegde, Ji, et al., 2016; Kelly, 2014; Kelly et al., 2014; Patel et al., 2018; Pathak et al., 2017; Pilarzyk et al., 2019; Pilarzyk et al., 2021; Porcher et al., 2021; Smith et al., 2021). In brief, age‐related changes in human mRNA were assessed by mining RNA sequencing data from the 2014 Allen Institute for Brain Science Brainspan database and the Aging, Dementia, and Traumatic Brain Injury (TBI) database, as we previously published (Farmer et al., 2020; Patel et al., 2018). In situ hybridization was conducted as previously described (Kelly, 2014; Kelly et al., 2014) using an 35S–labeled antisense probe (5′‐ccaccagttcctgttttccttttcgcatcaagtaatc‐3′), the sense correlate of which yielded no signal. As previously described, biochemical fractionation (Patel et al., 2018; Pathak et al., 2017; Porcher et al., 2021), immunofluorescence (IF)/immunohistochemistry (IHC) (Hegde, Capell, et al., 2016), social transmission of food preference (Hegde, Capell, et al., 2016; Pilarzyk et al., 2019), odor recognition (Hegde, Capell, et al., 2016; Pilarzyk et al., 2019), plasmid generation (Pathak et al., 2017), cell culture and transfections (Pathak et al., 2017), phosphodiesterase activity assays (Smith et al., 2021), stereotaxic surgery (Pilarzyk et al., 2019), and RNA sequencing (Hegde, Ji, et al., 2016) were conducted. 2‐dimensional difference in gel electrophoresis (2‐D DIGE) and mass spectroscopy (MS) for the phosphoproteomic study was conducted by Applied Biomics (Hayward, CA; https://www.appliedbiomics.com/2d‐dige/phosphoproteomics/), similarly to a study previously described (Pilarzyk et al., 2021) with some modification. See the Appendix S1 for a detailed description of each Method.
4.3Data analysis
Data were collected blind to treatment and experiments were designed to counterbalance technical variables across biological variables. Data points greater than two standard deviations away from the mean were removed as outliers prior to analyses, as previously described (e.g., Kelly et al., 2009; Kelly et al., 2014; Pathak et al., 2015; Pilarzyk et al., 2019). Outliers removed/total n: Figure 1o, 1/24; Figure 3a, 4/89; Figure 3b, 3/73; Figure 3c, 7/110; Figure 3i, 4/73; Figure 3l, 2/43; Figure 3m, 5/4; Figure 4l, 2/48; Figure S6F, 2/38; Figure S7C, 5/108. Data were analyzed for effect of genotype, age, behavioral parameter (e.g., bead and food), and sex for experiments with greater than 6/sex/genotype (Hegde, Capell, et al., 2016; Kelly et al., 2010; Kelly et al., 2014; Pilarzyk et al., 2019)). Where datasets met assumptions of normality (Shapiro–Wilk test) and equal variance (Levene's test), the following parametric statistical analyses were run on Sigmaplot 11.2 (San Jose, CA, USA): ANOVA (F), Student's t‐test (t), one‐sample t‐test (t; Table 1). In the case of one‐sample t‐tests (determining whether or not a given group demonstrated memory), a false‐rate discovery (FDR) correction was applied to all p‐values within an experiment to mitigate the risk of Type I error associated with multiple comparisons. Where normality and/or equal variance assumptions failed, the following non‐parametrical statistical analyses were run: Kruskal–Wallis ANOVA (H), Mann–Whitney rank sum test (T), or Wilcoxon Signed Rank Test (Z). Repeated measures analyses were used where appropriate (e.g., in analysis of behavior across multiple trials). Post hoc analyses were performed according to the Student–Newman–Keuls or Dunn's method and significance was defined as p < 0.05. Source data can be found in Appendix S2 and original uncropped images can be found in Appendix S3.
CONFLICT OF INTEREST
The authors report no conflicts of interest.
Supporting information
ACKNOWLEDGMENTS
The authors would like to thank Shweta Hegde, Nicolous Poupore, Abi Smith, David Smith, and Alex Sougianis for technical assistance with biochemical or behavioral assays as well as Sophie Bruckmeier for technical and editorial assistance. The authors would also like to thank Dr. Christina Sigurdson for introducing us to the concept of “ghost axons,” Drs. Steven Wilson and Seungjin Shin of the University of South Carolina Viral Core for lentiviral preparations, Dr. Mythreye Karthikeyan for the LAMP1 antibody and mycoplasma testing, and John at Applied Biomics for advice on sample preparation and experimental design of the phosphoproteomics study. The authors would like to thank Drs. David Oliver and Misha Shtutman at the University of South Carolina Functional Genomics Core for performing the alignment of the raw data generated by the Weil Epigenomics core along with the list of significantly changed mRNAs. Finally, the authors would like to sincerely thank Marlee Poole and the animal husbandry staff for taking such great care of our colony. Research supported by a SPARC Fellowship from the University of South Carolina Office of the Vice President for Research (KP), an NSF Graduate Research Fellowship (KP), University of South Carolina Magellan Scholar Program (WRC), the ASPET SURF Program (WRC), a SURF grant from the University of South Carolina Honors College (WRC), a senior thesis grant from the University of South Carolina Honors College (WRC), a Research Starter Grant in Pharmacology & Toxicology from the PhRMA Foundation (MPK), an ASPIRE award from the Office of the Vice President for Research from the University of South Carolina (MPK), a Research Development Fund Award from the University of South Carolina School of Medicine (MPK), a NARSAD Young Investigator Award from the Brain & Behavior Research Foundation (MPK), R01MH101130 from NIMH (MPK), R01AG061200 from NIA (MPK), P20GM109091 from NIGMS (MPK), and start‐up funds from the University of Maryland School of Medicine (MPK). The content of this manuscript is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.