Valsartan Mitigates LPS-Induced Neuroinflammation and Cognitive Deficits via Modulation of RAS–ECS Crosstalk in Mice
https://ror.org/02n85j827grid.419725.c0000 0001 2151 8157Pharmacology Department, Medical Research and Clinical Studies Institute, National Research Centre (NRC), 33 El Buhouth St., Dokki, Cairo, 12622 Egypt
https://ror.org/02n85j827grid.419725.c0000 0001 2151 8157Narcotics, Ergogenics and Poisons Department, Medical Research and Clinical Studies Institute, National Research Centre (NRC), 33 El Buhouth St., Dokki, Cairo, 12622 Egypt
https://ror.org/05debfq75grid.440875.a0000 0004 1765 2064Department of Pharmacology and Toxicology, College of Pharmaceutical Sciences and Drug Manufacturing, Misr University for Science and Technology, Giza, 12566 Egypt
Abstract
Neuroinflammation is a critical aspect implicated in cognitive dysfunctions and neurodegenerative ailments such as Alzheimer’s disease (AD). β-amyloid (Aβ) peptide deposits and alterations in behavior and memory are important contributors to neuro-inflammatory pathways. The renin-angiotensin system (RAS) and endocannabinoid system (ECS) play a vital role in the pathophysiology of AD. The aim of this study is to illuminate the ameliorative effect of the antihypertensive drug valsartan (VAL) against lipopolysaccharide (LPS)-induced AD and study the cross-talk between ECS and RAS. Thirty two male Swiss mice were randomly divided into 4 groups as follows: Normal control group; LPS group (250 µg/kg; ip); valsartan groups (20 and 40 mg/kg; po). All treatments continued daily with LPS for seven consecutive days. Neuroprotective effects exerted by VAL are emphasized by improving motor functions and enhancing animal performance via the activity cage and Y-maze behavioral tests respectively. VAL inhibited toll-like receptor 4 (TLR4), which in turn deactivated the tumor necrosis factor-α (TNF-α)/nuclear factor kappa-B (NF-κB) inflammatory pathway together with a reduction of angiotensin-1 receptor (AT1R1) levels as compared to LPS-injected animals. Additionally, VAL improved neuronal and cognitive dysfunction by reducing acetylcholine esterase activity (AChE) by 73% and amyloid beta (Aβ 1–42) by 53%, along with an elevation in the expression of cannabinoid 1 receptor (CB1R). Moreover, VAL enhanced the expression of protein kinase B (AKT) and heme oxygenase-1 (HO-1) gene levels and consequently restored the antioxidant cellular defense mechanism. VAL ultimately combats against microglial activation, mitigates cognitive dysfunction, and halts the neurodegenerative perturbations of LPS via inhibiting Aβ deposition, neuroinflammation, and RAS with stimulation of ECS.
Graphical Abstract
Introduction
Lipopolysaccharide (LPS) is a bacterial endotoxin that plays a key role in regulating immunity and inflammation. It functions as a common model used to demonstrate the pro-inflammatory activation of microglia inducing AD [1]. The neurotoxic LPS causes buildup of Aβ peptides, which are the principal components of amyloid plaques [2]. AD is one of the most ubiquitous neurodegenerative disorders associated with aging. It is characterized by a slowly progressive decline in cognitive and social functionality [3, 4]. Several factors are involved in the pathophysiological changes of the disease, such as deposition of Aβ peptides, formation of neurofibrillary tangles (NFTs), which consist of hyperphosphorylated tau (p-tau) aggregates in addition to microglial activation [5].
Several lines of evidence verified that neuroinflammation is an important contributor to the occurrence of AD [6, 7]. It is initiated when an inflammatory stimulus triggers the activation of microglia and/or astrocytes, resulting in an increased release of pro-inflammatory cytokines such as interleukin-1β (IL-1β), interleukin-6 (IL-6), TNF-α, and the transcription factor NF-κB that leads to further microglial activation with subsequent neurotoxicity and ultimately cellular apoptosis [8, 9]. Moreover, recent studies proved that chronic inflammation may increase the permeability of the blood–brain barrier (BBB) and accelerate cognitive deterioration and brain dysfunction [10]. LPS binds to TLR4 on microglia and activates NF-κB that proceeds through a series of inflammatory cascades and ends in enormous neurodegeneration [11, 12]. LPS-induced neuroinflammation is also coupled with cognitive deterioration, oxidative stress, and cholinergic dysfunction [13].
Previous reports have demonstrated that the homeostatic RAS plays a significant role in the pathogenesis of AD [14]. Angiotensin II serves as the primary regulator of RAS via AT1R and AT2R [15]. Subsequently, activation of these receptors leads to several neurodegenerative mechanisms involving oxidative imbalance, neuroinflammatory responses with production of pro-inflammatory cytokines, and apoptotic signaling [16]. VAL, an antihypertensive drug, is highly selective for blocking AT1R and so plays an essential role in cognitive dysfunction, inflammatory responses, suppressing production of reactive oxygen species (ROS), and restoring the antioxidant defense system in the brain [17]. Targeting ECS has become a viable therapeutic strategy to treat AD in its early stages. ECS is made up of lipid signaling molecules that influence immunity and cognition by attaching to at least two G-protein-coupled receptors (GPCRs) [18]. CB1R are found in astrocytes, microglia, and oligodendrocytes in addition to neurons [19]. CB1R appears to play an essential role as anti-neuroinflammatory and in neuroprotection. It is believed that microglial cell functions are affected by CB1R [20]. Kozela et al. [21] showed that ECS inhibits LPS-induced NF-κB and interferon β/signal transducers and activators of transcription (IFNβ/STAT) and neuroinflammatory pathways via CB1R. Additionally, as shown by Torika et al. [22], neuroinflammation is attenuated by ARBs via activation of AT1R. Therefore, activation of CB1R by ARBs sheds light on the modulatory effect of VAL as an anti-inflammatory and neuroprotective agent. Furthermore, protein misfolding, excitotoxicity, mitochondrial dysfunction, and oxidative stress are among the primary pathogenic processes that have been controlled by the endocannabinoid signaling during the silent phase of the neurodegenerative process [23]. Accordingly, the aim of this study is to evaluate the neuroprotective effect of VAL and study the crosstalk between the ECS and the RAS against cognitive decline and neuronal loss related to age-linked AD.
Material and Methods
Randomization and Blinding
All animals were randomly allocated to the experimental groups throughout the study. Personnel responsible for behavioural assessments were blinded and unaware of treatment allocation.
Animals
Male Swiss mice weighing between 20 and 30 g were chosen for the study. They were placed in plastic cages with filter tops under controlled conditions, including a 12-h light/dark cycle, 50% humidity, and a temperature of 23 °C. Throughout the experiment, the mice were fed a standard pellet diet and had access to water at all times. The animal experiments were carried out in accordance with the guidelines for the Care and Use of Laboratory Animals provided by the Ethical Committee of MUST, Egypt (approval no. PTREC.28).
Chemicals
LPS was purchased from Sigma-Aldrich (St. Louis, MO, USA). VAL was from Mylan Pharmaceuticals Inc. (Egypt). AChE, Aβ1–42, TLR4, NF-κB, TNF-α, AT1R1, and CB1R were estimated by using specific ELISA kits (SunLong Biotec Co., LTD, China). HO-1 and AKT gene expressions were measured using real-time polymerase chain reaction (RT-PCR).
Experimental Design
Intraperitoneal injections of LPS induce cognitive impairment resembling AD pathology in mice. Therefore, this approach was adopted in the present study to establish an AD-like mouse model.
Male Swiss mice of the NRC breeding colony were used (20–30 g). 32 mice were assigned to 4 groups (8 mice each) as follows: Group 1 (normal control group): mice received daily 1 mL saline i.p.; Group 2 (model group) mice received LPS in a dose of 250 µg/kg; intraperitoneal for 7 days [24]; Groups 3 and 4: mice received VAL in a dose of 20 and 40 mg/kg orally for 7 days concurrently with LPS [25]. After the experiment was completed, estimation of behavioral activity including Y-maze test and motor activity using the activity cage were conducted.
Motor Activity Test
The activity cage (Ugo-Basile, Model 7430, Italy) was used to measure motor activity using the infrared photocell concept. The activity cage produced a network of perpendicular light beams covering the bottom of the cage for assessment of the horizontal activity. Another set of 16 horizontal IR light beams was elevated 5 cm over the floor plane for measurement of the vertical activity (rearing). The beam interruptions were counted and recorded by an electronic unit connected to the activity cage [26].
Before putting the mice into the cage, they adapted to the test room for 1 h every day, with 3 training sessions (5 min each). At the end of the experiment, each mouse’s motor activity was assessed across 5 min [27].
Estimation of Behavioral Activity using Y-Maze
The Y-maze experiment was conducted following the methodology described by Hidaka et al. [28]. In the Y-maze, each of the three arms was labeled as A, B, or C. During the first phase, known as the training phase, the mouse was allowed to explore the maze for 8 min. In the second phase, conducted 24 h later, the mouse was permitted to navigate the maze once more for a duration of 8 min, during which its movements were documented. Alternations were defined as successive entries into three different arms in overlapping triplet sets (e.g., ABCBACA = 3 alternations). Total arm entries were simply the total number of arms entered (e.g., ABCBACA = 7 entries). The percentage of alternations was calculated by using the following formula [29]:
Tissue Biochemical Analysis
The mice were sacrificed by decapitation. The brains were immediately dissected and rinsed with phosphate-buffered saline (PBS) to remove any excess blood. Specific brain regions were subjected to weighing and homogenization with an MPW-120 homogenizer (Med Instruments, Poland) in phosphate-buffered saline (PBS) to produce a 20% homogenate, which was subsequently stored overnight at –20 °C. Following this, the homogenates were centrifuged at 5000 × g for a duration of 5 min utilizing a cooling centrifuge (Sigma and Laborzentrifugen, 2k15, Germany) [30]. The supernatant was promptly collected and analyzed for the brain contents of AChE, TLR4, Aβ1–42, NF-κB, TNF-α, AT1R1, and CB1R together with mRNA expression levels of AKT and HO-1.
Estimation of the brain content of AChE, TLR4, Aβ1–42, NF–κB, TNF–α, AT1R1 and CB1R Using Elisa technique
The wells were incubated for 30 min at 37 °C. Following incubation and washing, horseradish peroxidase-conjugated streptavidin was added to the wells and incubated for another 30 min at 37 °C. After a second wash, tetramethylbenzidine (TMB) substrate solution was added and incubated for 15 min at 37 °C, leading to color development proportional to the amounts of AChE, TLR4, Aβ1–42, NF-κB, TNF-α, AT1R1, and CB1R bound. The reaction was stopped with a stop solution, and the color intensity was measured at 450 nm after 10 min [31].
RNA Extraction and cDNA Synthesis
Approximately 30 mg of brain tissue was pulverized in liquid nitrogen and homogenized using a prechilled mortar and pestle. Total RNA was extracted using the Thermo Scientific GeneJET RNA Purification Kit according to the manufacturer’s instructions. RNA concentration and purity were assessed with a Nano Drop ND-1000 spectrophotometer. Subsequently, 1 µg of total RNA was reverse-transcribed into cDNA using the Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific), with reactions performed on a Bio-Rad gradient thermal cycler.
Real-Time PCR (RT-PCR) Quantification of HO-1 and AKT
The mRNA expression levels of HO-1 and AKT genes were determined using RT-PCR, which was standardized by co-amplification with the housekeeping gene B-Actin for HO-1 and the GAPDH gene for AKT as an internal control. HO-1 and AKT RNA were isolated from brain tissue with Trizol reagent. RNA was reverse-transcribed with M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and then amplified using specified primers. HO-1 was quantified using the HO-1 RT-PCR fluorescence diagnostic kit Cat. No. M.R. 246,187 in accordance with the manufacturer’s instructions. HO-1 forward primer 5′ ATGGCCACCCTGATCCACATC-3′ and HO-1 reverse primer 5′ TGTTGCGCTCAATCTCCTCCT-3′ were used to perform 40 cycles of 95 °C for 5 s, 65 °C for 30 s, 72 °C for 30 s, 1 min at 60 °C, and 2 min at 72 °C using a Rotor-Gene Q5 plex real-time Rotary analyzer (Corbettlife sciences, USA). AKT was quantified using the AKT RT-PCR fluorescence diagnostic kit Cat. No. A.B 517302 in accordance with the manufacturer’s instructions. AKT forward primer 5′-GTGGCAAGATGTGTATGAG-3′ and AKT reverse primer 5′-CTGGCTGAGTAGGAGAAC-3′ were used in a 40-cycle amplification using a Rotor-Gene Q5 plex real-time rotary analyzer (Corbettlife sciences, USA) at 95 °C for 5 s, 61 °C for 1 s, 72 °C for 30 s, 1 min at 60° C, and 10 min at 72 °C [32].
Gene
Forward primer (5′–3′) Reverse primer (5′–3′) HO-1 ATGGCCACCCTGATCCACATC TGTTGCGCTCAATCTCCTCCT- AKT-1 GTGGCAAGATGTGTATGAG CTGGCTGAGTAGGAGAAC GAPDH GACATGCCGCCTGGAGAAC AGCCCAGGATGCCCTTTAGT
Statistical Analysis
All values are presented as means ± standard deviation (SD) with n = 8 for each group. The data from this study were analyzed utilizing one-way analysis of variance (ANOVA), accompanied by Tukey’s multiple comparisons test. The analysis was conducted using GraphPad Prism software, version 5 (GraphPad Software Inc., San Diego, USA), and was used for the statistical analysis. Differences were considered significant at (p < 0.05).
The sample size was calculated using G-Power software version 3.1.9.4 (Fraz faul, Germany). The study has 4 independent groups. Prior data indicated a difference in the LPS group of approximately twofold in elevating AChE in comparison to a normal control group. Thirty-two mice were assigned to each study group to achieve an effect size (f) of 2.2 and a study power of 90% (1-β error probe). This number was needed to be able to reject the null hypothesis that the effect of the drug-treated group and normal control groups are equal. A continuity-corrected squared Fisher’s exact test will be used to evaluate this null hypothesis with a probability of type I error (α error = 0.05), power = 95%.
Histopathology
Autopsy samples were taken from the brain of mice in different groups and fixed in 10% formalin saline for 24 h. The specimens were initially washed with tap water, followed by a series of alcohol dilutions (methyl, ethyl, and absolute ethyl) for the dehydration process. Subsequently, the specimens were cleared using xylene and embedded in paraffin at a temperature of 56 °C in a hot air oven for a duration of 24 h. Tissue blocks made from paraffin beeswax were then prepared for sectioning at a thickness of 4 microns using a rotary LEITZ microtome. The obtained tissue sections were collected on glass slides, deparaffinized, and stained with hematoxylin and eosin stain for examination through the light electric microscope.
Discussion
The potential neuroprotective effects of VAL, an angiotensin II receptor blocker (ARB) frequently used to treat high blood pressure, in AD have drawn attention. This is due to its capacity to suppress AT1R that is implicated in neurodegenerative pathways [33]. In the present study, we investigate the role of VAL on cognitive dysfunction, Aβ accumulation, neuroinflammation, oxidative stress, and endocannabinoid system, all of which are important components implied in AD pathogenesis and cognitive impairment associated with LPS.
It was evidenced that LPS is the most broadly used model for neuroinflammation and microglial activation. Administering LPS results in deficiencies in a number of learning and memory domains, such as object identification, spatial memory, and alteration performance [34, 35]. In our research, we evaluate neurological function through the assessment of motor activity and Y-maze tests. The Y-maze test has been shown to reflect brain injury, assess cognitive impairments, and determine the effects of various medications on perception [36]. According to our findings and in consistency with others, LPS-treated animals revealed a decline in cognitive functions as shown by decreased motor activity and number of correct trials and percentage of alternations in the activity cage and Y-maze test. These findings are greatly maintained by Lee et al. [37]. However, VAL showed beneficial effects on cognitive functions and memory as evidenced by enhancing the motor activity and Y-maze performance of animals [38] (Fig. 1). These results are agreed upon by others [39], who confirmed that telmisartan and ARB were able to improve learning abnormalities in animals that had been damaged during AD. Consequently, these findings confirm the fundamental role of antihypertensive drugs in restoring the deficient memory and cognition induced by AD [17].
Many studies have explained the entire relationship between the cholinergic system, represented by acetylcholine (ACh), and the anti-inflammatory effects [40]. In particular, maintaining the levels of ACh by decreasing the activity of the enzyme responsible for its degradation, AChE, is of great importance in improving memory and learning disabilities [41]. Our study revealed that administration of LPS showed a marked elevation of AChE content in the brain homogenate, which is agreed by Arikawa et al. [42]. While, VAL mitigated this cognitive decline by decreasing the levels of AChE activity (Fig. 2). Additionally, the activity of AChE may be affected by the integrity of the plasma membrane, which is impaired by the neurotoxic effect of LPS [43].
Excessive inflammation may result in the release of damage-associated molecular patterns from compromised cells [44]. These patterns are subsequently recognized by TLR4 and trigger an inflammatory response. This response not only exacerbates the progression of the disease but ends in the buildup of brain Aβ [44, 45]. As reported by Saviano et al. [46], who demonstrated that injection of Aβ1–42 peptides in mice results in acquisition disability. Our study reported that injection of LPS increased the levels of Aβ1–42 in the brains of mice. Our results agreed with Mahmoud et al. [47], who concluded that LPS is an inducer of inflammation via Aβ accumulation and NFTs formation. In contrast, administration of lower and higher doses of VAL decreased amyloid plaques deposition and prevented the Aβ-induced learning deficits (Fig. 2). These results are supported by the findings of Karran et al. [48], who rationalized the reduction in Aβ aggregates to the increase in its degradation by insulin-degrading enzymes and enhancing the transfer of Aβ from the brain to the peripheral tissues, an action which is augmented by VAL.
Increased expression of TLR4 within the brain initiates a pro-inflammatory cascade of cytokines [49]. Hence, our study showed that LPS-treated animals revealed a significant increase in TLR4, NF-κB, and TNF-α brain content, which is allied with previous studies [47, 50]. In addition, Zarezadeh et al. [9] proved a significant overexpression of TNF-α and NF-κB levels in dementia-treated rats. Conversely, inhibition of NF-κB activation has a neuroprotective display in LPS-induced microglial excitation in neuroinflammatory diseases [51]. Our results revealed a significant reduction in the levels of NF-κB, TLR4, and TNF-α in VAL-treated animals (Fig. 3). These findings are supported by Varagic et al. [52], who demonstrate the neuroprotective mechanism of VAL against inflammation. In alignment with previous work, VAL decreased the release of inflammatory mediators in numerous pathological disorders associated with cardiovascular and pulmonary diseases [53]. An earlier study showed that VAL suppresses the release of TNF-α in LPS-induced blood sepsis and restored them back to normal values [54]. Moreover, VAL exerted antifibrotic/profibrotic cytokine regulating activity via reducing the gene expression of NF-κB in bleomycin-induced pulmonary fibrosis [55]. Moreover, other studies have shown that VAL has a significant role in the downregulation of inflammatory mediators in autoimmune myocarditis [56].
Preclinical and clinical studies verify that memorial dysfunction and emotional stress are regulated by brain RAS [38]. Treatment with RAS inhibitors has been linked to a decrease in brain damage in variant models of neurodegenerative disorders [57].
Angiotensin 1, 2, and 4 receptors (AT1R, AT2R, and AT4R, respectively) are the primary mechanisms by which RAS is functioning. Activation of AT1R stimulates apoptotic signals, inflammation, mitochondrial ROS production, and neurodegenerative AD [58]. In the current investigation, VAL dramatically lowered AT1R1 expression in comparison to the LPS control group which may reduce the chance of developing AD [59] (Fig. 4). Consistently with Mogi et al.’s [60] findings, which showed that telmisartan, a particular AT1 inhibitor, can prevent cognitive decline in a mice model of AD [60].
Interestingly, various studies proved that the ECS is another significant component implicated in the therapy of AD [61]. It was proved that tetrahydrocannabinol (THC) can reduce Aβ aggregation by interacting directly with Aβ peptides [62]. Moreover, the potential use of endocannabinoids was reported for treating neuropathic pain in multiple sclerosis and other neurological diseases [63]. Recent evidence shows that there are interactions between the RAS system and the ECS, regulating vascular contraction caused by Ang II, which can occur via activation of CB1R [19]. CB1R activation in vivo has been shown to reduce neuronal loss in the hippocampus and decrease infarct volume following cerebral ischemia [64], acute brain trauma [65, 66], and ouabain-induced excitotoxicity [66]. Given that CB1R activation by VAL possesses both neuroprotective and anti-inflammatory properties (Fig. 4). Our research could pave the way for the application of these substances to control the inflammation in the early stages of AD.
Complying with former studies, it was reported that the phosphoinositide-3-kinase (PI3K)/AKT pathway serves as a crucial mechanism for cellular survival [67]. Our results showed that the expression of AKT genes had been decreased in a group of animals treated with LPS, which was confirmed by others [68]. However, low and high doses of VAL demonstrated a significant increase in such levels as compared to LPS-treated mice (Fig. 5). These results are supported by Gouveia et al. [69], who explained that the Pik3ca mRNA levels were attained at the normal values in the LPS group treated previously with irbesartan compared to the non-treated group.
Oxidative stress and excessive release of ROS result in tissue injury and propagation of the inflammatory cascade [70, 71]. Likewise, it was reported that the nuclear factor E2-related factor 2 (Nrf2)/HO-1 signaling pathway has a fundamental role in cognitive deficit and memory [72]. Therefore, our work demonstrated that the level of HO-1 had been significantly decreased in the group of animals treated with LPS. Meanwhile, treatment with VAL 20 and 40 mg/kg resulted in a significant increase in HO-1 levels (Fig. 5). This result coincides with others, who proved that the Nrf2/HO-1 mechanism improved the cognitive dysfunction induced by trimethyltin chloride in mice [73]. Moreover, it was believed that the activity of the Nrf2/HO-1 pathway was increased and enhanced the synaptic dysfunction and neuronal apoptosis caused by the deposition of Aβ1–42 [74]. Other results concluded that LCZ696, which is composed of sacubitril/VAL and used to treat heart failure, may enhance the cognitive disability induced by methamphetamine through the Nrf2/HO-1 signaling mechanism in the mice model [75]. Furthermore, our results boost the findings of Yang et al. [76] who explored the neuroprotective effect of VAL against cognitive dysfunction induced by aluminum chloride, which may be due to reduced formation of ROS and enhanced abilities of antioxidant enzymes such as superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px).
According to the histopathological observations of different brain tissues, it was revealed that LPS-treated animals had shown nuclear pyknosis and degeneration in most of the brain neurons, in addition to multiple eosinophilic plaques formation that were seen in the striatum (Fig. 6e–h). Our results agree with others [77, 78] who reported that injections of LPS exacerbate neuroinflammation with deposition of Aβ in the hippocampus that lead to apoptosis, cognitive decline, and neuronal cell death. On the other hand, the current study reported that inhibition of RAS and activation of ECS by VAL had improved the histological structure of the brain neurons (Fig. 6i–p). These findings were proved by other studies who confirmed that inhibition of brain RAS by using VAL and captopril reduced the histopathological problems of the brain by decreasing oxidative/nitrosative damage [17].
Despite our promising findings, the acute LPS model represents transient rather than chronic neuroinflammation, progressive pathology characteristic of human AD, which may limit the translational relevance of our results. Furthermore, our study focused on mRNA expression levels of AKT and HO-1 and potential interactions between VAL and the ECS; these results remain speculative and require direct experimental validation. Future studies should address validation at the protein level (e.g., Western blot or immunohistochemistry) to strengthen this translational relevance.
Conclusion
Our study offers compelling evidence of VAL as a potential modulator of neuroinflammation via RAS–ECS interaction. VAL caused activation of CB1R and controlled cognitive dysfunction induced by LPS in mice.
Acknowledgements
We would like to thank Dr. Adel Bakeer, Pathology Department, Faculty of Veterinary Medicine, Cairo University, for advice on the histopathological study.
Funding
Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).
Data Availability
The authors declare that the data supporting the findings of this study are available within the paper and its Supplementary files. Any other data files are available from the corresponding author upon reasonable request.
Declarations
Ethics Approval
The animal experiments were carried out in accordance with the guidelines for the Care and Use of Laboratory Animals provided by the Ethical Committee of MUST, Egypt (approval no. PTREC.28).
Consent to Participate
All authors have participated in the manuscript.
Consent for Publication
All authors have consented for publication of the manuscript in the Journal of Molecular Neurobiology.
Competing Interests
The authors declare no competing interests.