In silico genome-wide analysis of homeodomain-leucine zipper transcription factors in Cannabis sativa L
Pharmacy of College, Heilongjiang University of Chinese Medicine, Harbin, China
Department of Chinese Medicine, Jiamusi Campus, Heilongjiang University of Chinese Medicine, Jiamusi, China
Key Laboratory of Basic and Application Research of Beiyao (Heilongjiang University of Chinese Medicine), Ministry of Education, Harbin, China
Institute of Economic Crops, Heilongjiang Academy of Agricultural Sciences, Harbin, China
Academy of traditional Chinese medicine, Heilongjiang University of Chinese Medicine, Harbin, China
⁎Corresponding author. Pharmacy of College, Heilongjiang University of Chinese Medicine, Harbin, China. mawei@hljucm.net⁎⁎Corresponding author. zyylxb@foxmail.comAbstract
HD-Zip (Homeodomain-Leucine Zipper) is a family of transcription factors unique to higher plants and plays a vital role in plant growth and development. Increasing research results show that HD-Zip transcription factors are widely involved in many life processes in plants. However, the HD-Zip transcription factor for cannabis, a valuable crop, has not yet been identified. The sequence characteristics, chromosome localization, system evolution, conservative motif, gene structure, and gene expression of the HD-Zip transcription factor in the cannabis genome were systematically studied. Real-time quantitative polymerase chain reaction (qRT-PCR) was used to verify its function. The results showed that cannabis contained 33 HD-Zip gene members. The number of amino acids is 136–849aa, the isoelectric point is 4.54–9.04, and the molecular weight is 23264.32–93147.87Da. Many cis-acting elements are corresponding to hormone and abiotic stress in the HD-Zip family promoter area of cannabis. Sequencing of the transcriptome at 5 tissue sites of hemp, stems, leaves, bracts, and seeds showed similar levels of expression of 33 members of the HD-Zip gene family at 5 tissue sites. Bioinformatics results show that HD-Zip expression is tissue-specific and may be influenced by hormones and environmental factors. This lays a foundation for further research on the gene function of HD-Zip.
1Introduction
HD-Zip (homeodomain-leucine zipper) proteins, homeobox family proteins, are transcription factors unique to higher plants that play vital roles in plant growth and development. They have a highly conserved (HD) domains and leucine zipper (LZ) domains that can form "helix-loop-helix-turned-helical" folding structures [1]. The LZ domain is a stable zipper-like hydrophobic domain formed by specific polypeptide chains, including multiple leucine residues, that interact with other proteins and perform various functions. Based on the amino acid structural domain characteristics and sequence similarity, the HD-Zip gene family can be divided into four subfamilies: HD-Zip I, II, III, and IV, all of which contain conserved HD and LZ structural domains [2].
Cannabis sativa L. is an annual herb belonging to the Cannabaceae and is one of the oldest domesticated plants worldwide [3]. Cannabis contains many active medicinal ingredients such as terpenes, flavonoids, phenolic terpenoids, and alkaloids [4]and was first used as a medicinal plant in the Middle East and Asia as early as the 6th century BC. Cannabis was introduced to Western medicine in the early 19th century [5]. To date, 565 compounds have been isolated from cannabis, which can be classified as cannabinoids or non-cannabinoids, 120 of which are phytocannabinoids. Cannabinoids are the only phenolic terpenoid secondary metabolites in cannabis whose structure is derived from geranyl pyrophosphate [6]. Tetrahydrocannabinol (THC) was the first cannabinoid to be discovered and studied and is known for its psychoactive properties [7]. Due to its hallucinogenic and addictive properties, it can only be used for medical research under state laws and regulations. Cannabidiol (CBD) is a high-level, fat-soluble, non-psychoactive cannabinoid and the second major active ingredient in cannabis. Compared to THC, CBD is not hallucinogenic, safer, reduces THC side effects, and does not affect movement or memory function.
HD-Zip transcription factors are extensively involved in plant growth, morphogenesis, and biological and abiotic stresses, among other life processes [8]. The function and number of members of the four HD-Zip subfamilies vary depending on their structures [9]. Among them, the HD-Zip I subfamily proteins are involved in the regulation of plant processes such as response to adversity in response to abiotic and biotic environmental factors, hormone response, response to light signals, and organ development. The HD-Zip II subfamily is involved in plant organ development and is related to light response and hormone response. The HD-Zip III subfamily is mainly involved in apical meristematic tissue differentiation, vascular tissue formation, apical meristem differentiation regulation, vascular tissue formation, polar transport of growth hormones, embryonic development, and lateral organ development in the proximal region [10]. Finally, the HD-Zip IV subfamily controls trichome production, anthocyanin accumulation, and epithelial cell differentiation. In the Arabidopsis thaliana model plant, the Arabidopsis subfamily I has 17 members, the Arabidopsis subfamily HD-Zip II has 10 members [11], and the HD-Zip III and HD-Zip IV subfamilies have five and 16 members [12], respectively. During disease resistance, plants exhibit various physiological and biochemical responses controlled by transcription factors [13]. The HD-Zip gene, which is associated with various plant growth processes and stress responses, is considered a key transcription factor for plant germplasm improvement. For example, Oshox22 binds to CAAT (G/C)ATTG elements to enhance rice sensitivity to ABA signaling and regulate drought resistance and salt tolerance [14]. Furthermore, the cotton HD-ZIP Type I transcription factor (GhHB12) is specifically expressed in axillary buds and interacts with GhSPL10 and GhSPL13 to inhibit GhFT, GhFUL, and GhSOC1 expression and regulate cotton flowering time [15]. In Medicago truncatula Gaertn., the HD-Zip transcription factor HB1 is expressed in primary and lateral root meristem tissues and enhances tolerance to salt stress by regulating the contact area of the root system with saline soil [16]. However, studies on HD-Zip transcription factors in cannabis have not been reported; therefore, we aimed to use bioinformatics to predict the potential biological function of HD-Zip transcription factors and identify regulatory genes that influence the biosynthesis of cannabinoids, providing a rationale for selecting and cultivating high-quality cannabis varieties with high CBD and low THC content.
2Materials and methods
2.1Data sources and plant materials
The genomic data from the study was obtained from female strains of the cannabis CRBRx strain from the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/)(GCA_900626175.1) [17,18]. Transcriptome data included RNA-seq data of flowers, bracts, leaves, stems, and roots of female DK varieties (PRJNA498707). The fragments per kilobase of transcript per million mapped reads (FPKM) value of HD-Zip was extracted from the RNA sequencing (RNA-seq) data of Cannabis sativa L. The HD-Zip gene expression was visually analyzed by TBtools software, and all FPKM values were processed by row scaling [19].
2.2HD-Zip transcription factor identification and analysis in cannabis
The PlantTFDB website (http://planttfdb.gao-lab.org/) predicted the possible HD-Zip transcription factors, further screened the domains of the candidate sequences through the CD-Search tool (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and Pfam database (PF02365), and removed the redundancy to obtain the HD-Zip gene family members. The ExPASy website (https://web.expasy.org/protparam/) was used to predict the size, relative molecular mass, theoretical isoelectric point, and average hydrophilic coefficient of the HD-Zip cannabis protein sequence. HD-Zip subcellular localization was observed using the WoLFPSORT website (http://www.genscript.com/wolf-psort.html), and the chromosomal distribution was visualized using TBtools software [20].
2.3Multiple sequence comparison and phylogenetic analysis of cannabis HD-Zip transcription factors
Comparative analysis of the conserved structural domains of the cannabis HD-Zip proteins was performed using the DNAMAN 9.0 software. Obtain the HD-Zip protein data of Arabidopsis thaliana in the PlantTFDB database, and merge it with the marijuana HD-ZIP protein file. The MUSCLE program in MEGA7.0 software (http://www.megasoftware.net) was used to perform multiple sequence alignment and use MEGA-X software to use the Neighbor-joining (NJ), the Bootstrap value Set to 1000 times to build a system evolution.
2.4Structural and motif analysis of the cannabis HD-Zip transcription factor
Gene structure was analyzed using TBtools software, and conserved motifs were predicted using the online website MEME (http://meme-suite.org/tools/meme) [19], the maximum number of motifs were set to 18 and other settings of default parameters, and the evolutionary tree of gene structure and motifs combined with the cannabis HD-Zip transcription factor was visualized using TBtools for visualization. Conserved domains in CsHD-Zip proteins were forecasted using the NCBI website's CD-Search tool, displayed alongside the CsHD-Zip phylogenetic tree.
2.5Prediction of cis-acting elements of the cannabis HD-Zip transcription factor
The 2000 bp sequence upstream of the cannabis HD-Zip coding genes was extracted using TBtools software as a cis-element sequence in the promoter region, and the sequence was submitted to PLANTCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) for cis-acting element prediction [19]. The resulting files were filtered and categorized for visualization.
2.6Expression analysis of cannabis HD-Zip transcription factors
Using the transcriptome data of flowers, bracts, leaves, stems, roots, and seeds [21], the Dinafem (named Dinamed Kush) variety female plant was obtained by the group using a cross between Purple Kush and Dinamed Autoflowering CBD. The heat map was plotted using TBtools software for clustering and differential expression analysis [19].
2.7Real-time fluorescence quantitative PCR validation of cannabis HD-Zip transcription factors
Fragments per kilobase of transcript per million mapped (FPKM) reads values of HD-Zip transcription factors were extracted from HD-Zip transcription factors expression heat maps established using TBtools software. The FPKM values were treated using row-scale transformation. Transcriptome data were validated by qRT-PCR. Total RNA was first extracted using the RNA Easy Fast Plant Tissue Kit (Tiangen Biotech Co., Ltd., Beijing, China), followed by reverse transcription of the RNA to cDNA using the Fastking RT Kit (With DNase) (Tiangen Biotech Co., Ltd., Beijing, China). Finally, StarLighter HP SYBR Green qPCR Mix (Universal) (Beijing Foreverstar Biotech Co., Ltd., Beijing, China) was used for qRT-PCR assays using cDNA as a template. The EF1α gene was used as the reference gene. The qRT-PCR primers used in this study are listed in Table S1. The PCR amplification conditions used for all reactions were as follows: 3 min at 95 °C, followed by 40 cycles of 30 s at 95 °C, 20 s at 60 °C and 15 s at 72 °C. The relative expression of each gene was calculated using the 2-△△ Ct algorithm, and three technical replicates were set up for each experiment. These experimental steps were performed according to the manufacturer's instructions. The qPCR primers were designed using the qPCR primers Primer Premier (version 5.0) software and synthesized for this study at Rebbosinko Biotech Ltd. In Beijing.
3Results
3.1Cannabis HD-Zip and its physicochemical properties
By identifying the structural domains, 33 members of the cannabis HD-Zip family were identified. Based on the chromosomal localization of HD-Zip, the 33 members were named CsHD1-CsHD33 (Fig. 1). In the cannabis HD-ZIP family, each HD-ZIP gene can be found to find matched chromosomal information. The distribution is evenly distributed on 10 chromosomes. Chromosomes 2 and 10 have many genes, containing seven and eight CSHD genes, Chromosome 1 contained one CsHD gene, chromosome 3 contained two CsHD genes, chromosome 4 contained four CsHD genes, chromosome 5 contained five CsHD genes, chromosome 6 contained one CsHD gene, chromosome 7 contained one CsHD gene, chromosome 8 contained two CsHD genes, and chromosome 9 contained two CsHD genes.
Analysis of members of the cannabis HD-Zip gene family using correlation analysis sites (Table 1) revealed amino acid counts ranging from a low of 136 aa to a high of 849 aa. The isoelectric points from 4.54 to 9.04, the relative molecular mass ranged from 23264.32 Da to 93147.87 Da, and the GRAVY values were negative (from −0.107 to −1.264), indicating that all hemp HD-Zip proteins are hydrophilic proteins but have different degrees of hydrophilicity. The prediction of subcellular localization showed that all the proteins except CsHD20 were located in the cytoplasm. These results may provide a theoretical basis for the study of the family functions of the HD-Zip gene in cannabis.Gene name Locus name Accession NO. Location aa Subcellular location pI M.W
(Da)GRAVY CsHD1 LOC115714257 rna-XM_030642892.1 72110347-
72111990327 nuclear 6.07 38 005.78 −1.128 CsHD2 LOC115706074 rna-XM_030633590.1 67468999-
67470620320 nuclear 5.42 36 805.48 −1.090 CsHD3 LOC115706377 rna-XM_030634009.1 83514970-
83521795333 nuclear 7.30 36 865.70 −0.826 CsHD4 LOC115706571 rna-XM_030634260.1 87067285-
87073409840 nuclear 5.69 91 329.15 −0.348 CsHD5 LOC115704522 rna-XM_030631725.1 88864933-
88865886247 nuclear 9.04 28 809.07 −1.041 CsHD6 LOC115707515 rna-XM_030635513.1 93979858-
93986884837 nuclear 5.94 92 068.43 −0.134 CsHD7 LOC115708255 rna-XM_030636476.1 98418784-
98423894772 nuclear 5.81 84 561.23 −0.364 CsHD8 LOC115707829 rna-XM_030635910.1 98581016-
98585765755 nuclear 5.64 83 575.46 −0.457 CsHD9 LOC115709290 rna-XM_030637356.1 12044206-
12046199347 nuclear 4.54 39 126.85 −0.755 CsHD10 LOC115708712 rna-XM_030636707.1 49693567-
49696348249 nuclear 7.71 27 860.30 −0.847 CsHD11 LOC115714770 rna-XM_030643524.1 18199201-
18204059734 nuclear 6.33 79 965.59 −0.328 CsHD12 LOC115715244 rna-XM_030644084.1 67793604-
67796239348 nuclear 5.27 39 339.10 −0.859 CsHD13 LOC115712233 rna-XM_030640495.1 70722710-
70724404301 nuclear 8.63 32 984.09 −0.654 CsHD14 LOC115714457 rna-XM_030643176.1 83654078-
83655827214 nuclear 6.16 25 043.36 −0.907 CsHD15 LOC115715621 rna-XM_030644277.1 60988-
62153204 nuclear 8.87 24 629.62 −1.264 CsHD16 LOC115716687 rna-XM_030645541.1 25253647-
25260730761 nuclear 5.62 83 208.70 −0.281 CsHD17 LOC115716879 rna-XM_030645791.1 45211201-
45218371814 nuclear 5.66 90 670.40 −0.458 CsHD18 LOC115716550 rna-XM_030645362.1 49440555-
49447624814 nuclear 5.62 90 647.37 −0.458 CsHD19 LOC115716393 rna-XM_030645179.1 78150464-
78152717330 nuclear 8.21 36 771.94 −0.817 CsHD20 LOC115719260 rna-XM_030648226.1 93220975-
93226670845 cytoplasmic 5.80 92 266.92 −0.107 CsHD21 LOC115723870 rna-XM_030653335.1 46829690-
46836379737 nuclear 6.41 81 729.85 −0.329 CsHD22 LOC115725296 rna-XM_030654760.1 57241171-
57243123399 nuclear 7.17 44 591.80 −1.114 CsHD23 LOC115695550 rna-XM_030622607.1 77222014-
77223744139 nuclear 6.14 16 154.02 −1.069 CsHD24 LOC115697662 rna-XM_030624750.1 1743268-
1743785136 nuclear 8.46 15 942.65 −1.204 CsHD25 LOC115697202 rna-XM_030624117.1 63113580-
63120239849 nuclear 5.76 93 147.87 −0.187 CsHD26 LOC115701102 rna-XM_030628797.1 5892080-
5893934321 nuclear 4.88 36 235.93 −0.815 CsHD27 LOC115699352 rna-XM_030626707.1 15574919-
15577141309 nuclear 6.42 35 242.97 −0.990 CsHD28 LOC115701160 rna-XM_030628868.1 26309613-
26311521357 nuclear 8.57 39 434.83 −0.795 CsHD29 LOC115700801 rna-XM_030628454.1 31944245-
31947663231 nuclear 8.37 26 638.14 −0.823 CsHD30 LOC115698490 rna-XM_030625561.1 51193527-
51194520205 nuclear 8.77 23 264.32 −0.660 CsHD31 LOC115699242 rna-XM_030626545.1 52728392-
52735653740 nuclear 5.63 80 726.23 −0.322 CsHD32 LOC115700934 rna-XM_030628613.1 60038579-
60042676328 nuclear 4.88 36 590.95 −0.933 CsHD33 LOC115700384 rna-XM_030627943.1 61131724-
61133917380 nuclear 6.51 43 560.28 −1.244
3.2Evolutionary relationships of cannabis HD-Zip genes and analysis of covariance
To understand the evolutionary relationship between the HD-Zip gene family and cannabis, a phylogenetic tree was constructed based on 81 proteins from Cannabis sativa and Arabidopsis thaliana (Fig. 2). The cannabis HD-Zip family comprises four subfamilies. Of these, 14 were HD-ZipI, seven were HD-ZipII, three were HD-ZipIII and nine were HD-ZipIV.
Collinearity analysis of Cannabis sativa with Oryza sativa (rice) and Arabidopsis thaliana revealed that there were 20 homologous gene pairs, with 12 pairs of homologous genes common to these three species (Fig. 3). Between C. sativa and rice, four pairs of similar genes were discovered, and an additional 16 pairs of similar genes were found between C. sativa and Arabidopsis.
3.3Conserved motifs and gene structure of cannabis HD-Zip
The MEME website (https://meme-suite.org/meme/tools/meme) was used to analyze the conserved motifs of the cannabis HD-Zip protein online, and the upper limit of the number of conserved motifs identified was 18, named motif 1–18. Utilizing TBtools software for visualization, the findings revealed (Fig. 4A&4B) that CsHD-Zip conserved motif count varied between 3 and 15, among which, the members of HD-Zip subfamily I and subfamily II both contained only The three members of HD-Zip subfamily III all contain motif 1, motif 2, motif 6, motif 14, motif 9, motif 4, motif 7, motif 12, motif 18, and CsHD-Zip20 also contains motif 13. The members of the HD-Zip IV subfamily include motif 2, motif 1, motif 16, motif 5, motif 14, motif 9, motif 4, motif 15, motif 7, motif 10, motif 17, motif 3, motif 11, motif 8, and motif 13.
Intron and exon analysis of CsHD-Zip gene family members revealed that the number of introns in members of the same subfamily was relatively consistent, however, the number of introns and exons in members of different subfamilies differed significantly (Fig. 4C). Differences in intron and exon numbers in the cannabis HD-Zip gene reflect structural diversity among members of the cannabis HD-Zip family, whereas exon numbers are more uniform among members of the same branch of the evolutionary tree.
3.4Cannabis HD-Zip gene cis-elements prediction
Cis-acting elements and trans-interactions can regulate gene expression, and analysis of their upstream cis-acting elements can predict the potential function of the corresponding genes. In the cannabis HD-Zip gene family, cis-elements are present in the promoter regions of each gene. Statistical analysis of the cis-elements revealed that photoreactive elements were the most abundant (Fig. 5), followed by hormone-like cis-elements (gibberellin, baicalin, salicylic acid, growth hormone, and methyl jasmine). Three genes, CsHD-Zip16, CsHD-Zip17, and CsHD-Zip18, had the highest number of MeJA-responsive elements at positions 3, 5, and 5, respectively.
3.5Heat map of cannabis HD-Zip expression pattern with qRT-PCR validation
Analysis of the expression patterns of cannabis HD-Zip gene family members in different tissue sites revealed that in flowers CsHD-1, CsHD-2, CsHD-3, CsHD-4, CsHD-8, CsHD-9, CsHD-10, CsHD-12, CsHD-13, CsHD-14, CsHD-15, CsHD 17, CsHD-18, CsHD-19, CsHD-20, CsHD-22, CsHD-25, CsHD-27, CsHD-28, CsHD-30, CsHD-31, CsHD-32, CsHD-33, 23 genes were highly expressed (Fig. 6). CsHD-5, CsHD-1, CsHD-11, CsHD -16, CsHD-21, CsHD-23, CsHD-24, CsHD-26, and CsHD-29, a total of nine genes, exhibited low expression in all five tissues. The highest expression of CsHD-9 was observed in the stems, leaves, flowers, and bracts.
In this study, five CsHD genes were randomly selected for qRT-PCR validation (Fig. 7), and their expression of 5 genes at different tissue sites was consistent with the transcriptome data.
4Discussion
Cannabis sativa L. has attracted the interest of scientists in recent years because of its abundance of phenolic terpenoids, flavonoids, terpenoids, and other important pharmacologically active components [22]. HD-Zip, a family of transcription factors unique to higher plants, plays a significant role in plant growth and development and is extensively involved in plant growth and development [23], abiotic stress response [24], and other life processes, including inflorescence development [25], flowering time regulation, lateral root development regulation, and hormone and stress resistance regulation [[26], [27], [28], [29], [30], [31]]. Therefore, the present study analyzed cannabis HD-Zip transcription factors genome-wide using bioinformatics to predict the potential biological functions of HD-Zip transcription factors.
The correlation analysis website research of the cannabis HD-Zip gene family members indicated that the relative molecular weights ranged from 23264.32Da to 93147.87Da, the related amino acid counts ranged from 136 to 849aa, and their isoelectric points ranged from 4.54 to 9.04. The results indicated that all cannabis HD-Zip proteins were hydrophilic, but with different degrees of hydrophilicity. The expected subcellular localization of the hashish HD-Zip gene household participants confirmed that all proteins were positioned in the nucleus, except for the CsHD20 protein, which was positioned in the cytoplasm.
In this study, 33 members of the cannabis HD-Zip gene family were identified using bioinformatical analysis. According to the phylogenetic tree, the cannabis HD-Zip family was divided into four subfamilies: 14 in the HD-Zip I family, seven in the HD-Zip II, three in the HD-Zip III family, and nine in HD-Zip IV. Covariance analysis of cannabis with rice and Arabidopsis revealed 20 homologous gene pairs between the genes of the HD-ZIP family of cannabis and those of Arabidopsis and rice, of which 12 pairs were common to all three species. Homologous genes in different species maintain the same or similar functions during evolution, and the tissue expression pattern of genes is generally related to gene function [32]. Four homologous gene pairs were identified between cannabis and rice, while there were 16 additional homologous gene pairs of the HD-ZIP transcription factor family between cannabis and Arabidopsis, suggesting that homologous genes might have similar functions. To better verify transcriptome-related information, five randomly selected CsHD genes were identified by qRT-PCR. The results showed that the expression levels of the five genes in various tissues were consistent with the transcriptome-related data. These genes were similar to the Arabidopsis subfamily and could respond to light signal transduction and play a crucial role in the development of cannabis.
Cannabis HD-Zip gene family proteins contain multiple motifs; motifs 1 and 2 constitute the homeodomain and LZ structural domains, respectively, suggesting that motifs 1 and 2 are characteristic of hemp HD-Zip gene family proteins. Members of the same subfamily had similar motif types and numbers.
Medicinal cannabis contains a variety of natural plant products, and cannabinoids are the most important class of known compounds [33]. The process of cannabinoid metabolism and synthesis has been clarified, but the molecular regulation mechanism is unknown. Currently, the most studied cannabinoids are THC and CBD, both terpenoids and isomers of each other [34], and both active substances in cannabis with high levels and medicinal properties. In plant tissues, cannabinoids are synthesized in the carboxylated form. Cannabigerolic acid (CBGA), a common precursor of tetrahydrocannabinolic acid (THCA) and cannabidiolic acid (CBDA), has been studied extensively. These are synthesized under the catalysis of THCA synthase and CBDA synthase, respectively, and are gradually decarboxylated into THC and CBD upon drying [35]. Hormones are important endogenous growth regulators in plants and are trace signaling molecules that have a non-negligible effect on plant growth, development, and the associated gene expression [[36], [37], [38]]. Different concentrations of exogenous hormones affect various plant tissues and regulate the endogenous hormone levels, which in turn regulate plant growth and development [39].
The study still has some limitations, such as the small scope involved, and further careful verification and research are needed to determine its biological significance. In the subsequent experimental study, interaction analysis of hemp HD-Zip transcription factors could be carried out, and recombinant plasmids containing target genes and promoters were introduced into Agrobacterium and injected into tobacco. After culture, firefly fluorescence and sea kidney fluorescence luminescence values were measured on the injected leaves. The transient expression technique is one of the methods to study plant gene function, which has become more and more mature over the years. The target gene was constructed into the transient expression vector through the enzyme digestion link and then transferred into the plant. The target gene enters the plant and will be expressed in a very short time, and the gene product will be detected, which makes this technology have the characteristics of short test cycle, good repeatability, and high conversion efficiency. Now this instantaneous expression system has been established in many plants. When the reporter vector and the expression vector are transferred into the plant host cell by agrobacterium transformation, if the target gene in the expression vector is specifically bound to the promoter sequence in the reporter vector, the expression of the tagged gene in the reporter vector will be enhanced, and the fluorescence signal will be amplified. The interaction between the target gene and the target promoter can be proved by detecting the fluorescence value of the enzyme label. Agrobacterium-mediated transient expression system can make gene expression efficient, fast and simple. In the present study, this system has been established in a variety of plants, including model plants Arabidopsis and tomato, and other plants such as grapes and potatoes [40]. The technical principle of the Agrobacterium-mediated transient expression system is to construct foreign genes into cointegrated vectors or bivectors, and transform them into Agrobacterium tumefaciens by means of infection, vacuuming, osmosis and injection, so that the host system can come into contact with Agrobacterium, thereby allowing T-DNA to enter the plant somatic cell nucleus and achieve short-term expression [41].
Different cis-acting elements in gene promoter regions usually imply that the gene can respond to the corresponding hormone or stress induction [42]. In the cannabis HD-Zip gene family, each gene promoter region contains cis-elements, with the largest number of light-responsive elements, followed by hormone-like cis-elements. Analysis of the expression patterns of the members of the cannabis HD-Zip gene family in different tissue sites revealed that 23 genes were highly expressed in flowers. We sequenced the transcriptome of five tissue sites of cannabis, including flowers, stems, leaves, bracts, and seeds, and found that the expression of 33 cannabis HD-Zip gene family members converged among the five tissue sites. Bioinformatics suggested that the expression of this gene family may be affected by hormonal and external environmental factors, that cannabis HD-Zip genes have tissue expression specificity, and that genes specifically highly expressed in flowers may have important regulatory roles in the development of female cannabis flowers. This provides the theoretical basis for the subsequent functional study of HD-Zip genes.
5Conclusions
We systematically investigated the sequence characteristics, chromosomal localization, gene structure, conserved sequences, phylogeny, and differential gene expression of HD-Zip transcription factors in the cannabis genome. These results indicated that the HD-Zip gene in hemp has tissue-specific expression and may be influenced by hormones and external environmental factors. This study contributes to a more comprehensive understanding of the biological function of the cannabis gene family and lays a foundation for further study of HD-Zip gene function and the improvement of cannabis varieties.
Funding statement
Talent training project supported by 10.13039/501100010009General project of Heilongjiang Postdoctoral Fund (LBH-Z21028), the 10.13039/501100018570Central Government for the Reform and Development of Local Colleges and Universities (ZYRCB2021008) and Heilongjiang Touyan Innovation Team Program (HLJTYTP2019001). 10.13039/501100005046Heilongjiang Provincial Natural Science Foundation of China (YQ2020H029)Gene name Forward primer sequence (5′–3′) Revers primer sequence (5′–3′) CsHD4 CATTAATGGAATCGAGCCGT AGAGAGGACTTGTAGTTCCG CsHD8 CGAGAAGTTCGTTGGAGTTT ACCAGTTTCCACACTCCTAA CsHD10 GAACGCTTGTATGATGCTCT TCTCTTAGCATCCCCTTCAG CsHD18 AATGTTGCCTCATCAGGAAC TGCATGCTCTTCAACGTTAA CsHD31 AATGAAGACCCAGCATGAAC GCATTTTCGAGCCTCAAATG EF1α ACCAAGATTGACAGGCGTTC CCTTCTTCTCCACAGCCTTG
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.