CB2 receptor agonist AM1241 regulating the polarization of microglia reduces morphine tolerance through IL-4/STAT6 pathway
Department of Anesthesiology, 3201 Hospital, Hanzhong, China
Department of Anesthesiology, Harbin Medical University Cancer Hospital, Harbin, China
Department of Anesthesiology, The Fourth Hospital of Harbin Medical University, Harbin, China
Mingyue Zhang, Department of Anesthesiology, Harbin Medical University Cancer Hospital, No.150 Haping Road, Nangang District, Harbin, China. Email: zhangmingyue@hrbmu.edu.cnAbstract
Background:
Pain seriously impacts patients’ life quality. The use of morphine for pain is common, but tolerance limits its application in clinic. However, there is no exact mechanism for tolerance. In this study, we explored how microglial polarization and IL (interleukin)-4,along with a CB2 receptor agonist, affect reducing morphine tolerance.
Method:
The cells cultivated with morphine or combined CB2R agonist AM1241, CB2R antagonist AM630, CB1R antagonist AM281, and IL-4 inhibitor (IL-4I).Mice were injected with these drugs for 7 days, and hot plate behavioral tests were performed 30 min after administration respectively. Mice received a single morphine injection on day 8.Samples were taken post-tests. The expression of iNOS, SOCS3, IL-4 and STAT6 mRNA were detected by qPCR; the expression of iNOS, SOCS3, p-STAT6 and STAT6 protein were detected by Western blot. Inflammatory cytokines were detected with Elisa kit.
Results:
The M1 marker iNOS increased, the M2 marker SOCS3 decreased, p-STAT6 protein did not change, and the cytokines increased after morphine treatment. The paw withdrawal latency (PWL) value, IL-4 mRNA and p-STAT6 protein increased after AM1241 treatment, iNOS decreased and SOCS3 increased after AM1241 treatment, AM1241 decreased the pro-inflammatory cytokines, increased IL-4, IL-10 secretion. AM630 and IL-4I reversed the effect of AM1241 on PWL, M1 M2 markers.
Conclusion:
The polarization of microglia in the direction of M1 caused morphine tolerance, AM1241 increased the IL-4 mRNA and induced the phosphorylation protein of STAT6 to reduce the tolerance, and AM1241 induced microglia to polarization in the direction of M2. AM1241 regulated microglia polarization through IL-4/STAT6 pathway, thereby reducing tolerance.
Introduction
Pain has a seriously effect on patients’ quality of life. Morphine is commonly prescribed for moderate to severe pain; however, tolerance to morphine is a major concern that limits its clinical application.1bibr2-17448069251374281bibr3-17448069251374281–4 So far, the mechanism underlying morphine tolerance remains poorly understood. The identification of an effective method to alleviate tolerance and improve patient comfort for has become an urgent problem in clinical research.
Microglia are the main type of immune cell in the central nervous system.3,5 The polarization of microglia is divided into two phases: proinflammatory M1 state or anti-inflammatory M2 state. Furthermore, proinflammatory or anti-inflammatory factors corresponding to each state can be produced by polarized microglia.5bibr6-17448069251374281–7 Studies have demonstrated the neuroinflammatory response of microglia in diseases of the nervous system, such as stroke, Parkinson's disease (PD) and Alzheimer’s disease.8bibr9-17448069251374281–10 Emerging evidences suggests that glia-derived proinflammatory cytokines, including IL-1β, IL-6, and TNF-α,6,11,12 have a critical effect on morphine tolerance. In neuropathic pain, the expression of M1 microglia marker was found to be significantly increased.13,14 The use of drugs to stimulate the polarization of microglia towards the M2 state can promote the secretion of anti-inflammatory substances, thus effectively reducing pain. 13 Neuropathic pain and morphine tolerance have similar mechanisms. Therefore, we speculate that promoting the polarization of microglia towards the M2 phenotype, which reduces the expression of M1 type pro-inflammatory factors and increases the production of M2 type anti-inflammatory substances, may be beneficial for reducing morphine tolerance caused by pro-inflammatory cytokines.
Cannabinoid receptor 2 receptor (CB2R) belongs to the endocannabinoid receptor family, a type of G protein-coupled receptors, CB2R is widely present in microglia in the CNS.2,3,15 CB2R has a critical effect on the neuroinflammatory response.16,17 Previous studies have shown that CB2R agonists can reduce morphine tolerance by reducing microglia inflammatory responses3,16,18; however, the exact mechanism is still not clear. A previous study reported that CB2R activation regulates microglial polarization to the M2 phenotype in a model of neuroinflammation. 17 This causes a decrease in proinflammatory factors and an increase in anti-inflammatory factors.16bibr17-17448069251374281bibr18-17448069251374281–19 Therefore, the possible mechanism by which CB2R activation reduces morphine tolerance may involve the regulation of microglia polarization.
Interleukin-4 is a classic inducer of the M2 phenotype.7,20 A CB2R agonist has been shown to increase IL-4 release by microglia in a model of experimental autoimmune encephalomyelitis. 21 Borner et al. found that a CB2R agonist could induce the expression of IL-4 and activation of STAT6 by Jurkat T cells. 22 STAT6 is essential for microglial polarization to the M2 phenotype under IL-4 stimulation.23,24 Wang et al. proved that in a mouse mode of chronic unpredictable mild stress, microglial polarization toward the M2 phenotype exerts neuroprotective effects through activation of CB2R-STAT6 signaling. 25
Therefore, in this study, it is assumed that CB2R agonists could promote the polarization of microglia to the M2 phenotype through the IL-4/STAT6 pathway, which would lead to a decrease in the production of proinflammatory substances and alleviate morphine tolerance. This study aims to elucidate the molecular mechanism of CB2R regulation in morphine tolerance and establish a theoretical foundation for guiding clinical pain management.
Methods
Cell cultures and treatment
Mouse derived microglia (BV2, Pricella, Wuhan) and human derived microglia (HMC3, Otwo Biotech, Shenzhen) were maintained in DMEM (Pricella) containing 10% fetal calf serum (PAN) at 37°C in 5% CO2/95% air. BV2 was divided two or three times a week at a ratio of between 1: 4 and 1: 6. HMC3 was divided twice a week at a ratio of between 1: 2 and 1: 3.26,27 Microglial cells were treated with 1 ug·mL⁻¹ LPS (MedChemExpress, USA) for 30 min, followed by incubation with other drugs. 16
BV2 and HMC3 cells were divided into the following groups: (1) control group; (2) LPS group; (3) LPS+Mor group; (4) LPS+AM1241+Mor group; (5) LPS+AM281+ AM1241+Mor group; (6) LPS+AM630+AM1241+Mor group; (7) LPS+IL-4I+AM1241+Mor group. AM1241 was 30 min ahead of morphine, AM281, AM630 or IL-4I were 30 min ahead of AM1241, LPS was 30 min ahead of AM281, AM630 or IL-4I. The CB2R agonist AM1241 was obtained from APExBIO, while CB2R antagonist AM630, CB1R antagonist AM281 and IL-4I were obtained from MedChemExpress. Each group of microglia was then maintained in DMEM without serum at the indicated durations of 6 h and 24 h for RT-qPCR, western blot and ELISA.16,28
Animals
Male mice from the Institute of Cancer Research (ICR) were domesticated for 7 days before formal experiments (Experimental Animal Corporation, the Second Affiliated Hospital of Harbin Medical University, Harbin, China; CL), (18–22 g). Mice were maintained in an animal room at 22 ± 1°C under an automatic 12 h light/dark cycle, with food and water available ad libitum. The mice were divided into several experimental groups at random, and their behaviors were observed and recorded by blinded researchers. The experiments were conducted between 9:00 AM and 3:00 PM. All experiments were in line with the policies and recommendations of the International Association for the Study of Pain and were supported by the Animal Care and Use Committee of Harbin Medical University.
Drug administration
Drugs with dimethyl sulfoxide (DMSO): saline = 1:3 was diluted. Mice were grouped via randomization and a double-blind experiment was carried out. The mice were given by drugs in a certain order of administration.
There were 42 mice in this experiment. Mice in the chronic morphine treatment group received continuous subcutaneous (SC) injection of 10 mg·kg⁻¹ morphine for 7 days (vehicle (VEH) +M10 group, n = 6). The mice received 3 mg·kg⁻¹ AM1241 i.p. injection, to examine the effect of AM1241 on morphine tolerance, AM1241 was injected 30 min before morphine (the dose was determined by previous researches) (AM1241+M10 group, n = 6).2,3 Another group of mice received the CB2R antagonist AM630 (1 mg·kg⁻¹, AM630+AM1241+M10 group, n = 6), CB1R antagonist AM281 (1 mg·kg⁻¹, AM281+AM1241+M10 group, n = 6) or IL-4 inhibitor-1 (IL-4I) (1 mg·kg⁻¹, select by pre-test, see additional materials for details, IL-4I+ AM1241+M10 group, n = 6) 30 min before AM1241 together with morphine. The mice of the control group received an identical volume of vehicle and saline (solvent of morphine, VEH+SAL group, n = 6). The hot-plate test was performed 30 min after morphine.
All mice (except of VEH+SAL group) received 5 mg·kg⁻¹of SC morphine to evaluate tolerance on day 8, after injection of chronic morphine. 1 To assess the antinociceptive ability of morphine, the hot-plate test was performed 30 min after morphine treatment (n = 6 in each group). All data were included in the statistical analysis.
Hot-plate test
The hot-plate test was performed according to a previously described method. Involving the use of a hot-plate apparatus in a plastic cylinder (Technology & Market Corp., Chengdu, China) to determine the paw withdrawal latency of mice (PWL). The mice were placed individually on the hot plate at 52°C and the time elapsed before these mice licked their hind paw or jumped was recorded (latency).1,28 To avoid tissue damage, a time limit of 30 s was set. The test was performed every 5 min for a total of three times. The average value was used for subsequent data analysis.
Reverse transcription-quantitative polymerase chain reaction
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to analyze the mRNA expression of in cells of the L3/L4/L5 of the spinal cord in mice (SC) (n = 3) and cells. Total RNA was isolated with Trizol (Invitrogen, Carlsbad, CA, USA). Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) was used for complementary deoxyribonucleic acid (cDNA) synthesis. The primer sequences for iNOS, SOCS3, IL-4 and STAT6 primers, designed by PrimerExpress software (ABI; Applied Biosystems, Foster City, CA, USA) are shown in Table 1. GAPDH was used as the endogenous control. The ABI stepone plus real-time PCR system was used to perform quantitative PCR amplification according to manufacturer's instructions (Applied Biosystems, Inc., Carlsbad, CA).
| gene | Forward primer (5' -3' ) | Reverse primer (5' -3' ) |
|---|---|---|
| GAPDH* | CTCCACTCACGGCAAATTCA | GCCTCACCCCATTTGATGTT |
| iNOS* | GCCTTGGCTCCAGCATGTAC | TTCGTCCCCTTCTCCTGTTG |
| SOCS3* | AGCCGACCTCTCTCCTCCAA | CAGGCAGCTGGGTCACTTTC |
| IL-4* | GGAGATGGATGTGCCAAACG | GCACCTTGGAAGCCCTACAG |
| STAT6* | TCAGATCGGCTGATCATTGG | TGACGTGTGCAATGGTGATG |
| GAPDH | CACCCACTCCTCCACCTTTGA | ACCACCCTGTTGCTGTAGCCA |
| iNOS | GGCTGCCAAGCTGAAATTGA | TCCTTCTTCGCCTCGTAAGG |
| SOCS3 | TGGCCACTCTTCAGCATCTCT | TCCAGGAACTCCCGAATGG |
| IL-4 | TGTGCTCCGGCAGTTCTACA | AGGTTCCTGTCGAGCCGTTT |
| STAT6 | TTTTGGCAGTGGTTTGATGGT | CGTCGGGCTCATTGAGAAGA |
Western blot assays
To detect the protein expression of iNOS, SOCS3, STAT6 and p-STAT6, proteins were isolated from the L3/L4/L5 SC in mice (n = 3) and different group of BV2 and HMC3 cells. Mice (n = 6 for each group) were anesthetized with 60 mg/kg pentobarbital sodium (60 mg/kg) and the tissues were harvested by decapitation after PWL on day 8. The samples were homogenized in frozen Protein Lysis Buffer (Beyotime Institute of Biotechnology) containing the protease inhibitor benzene methane sulfonyl fluoride (1 nM; Beyotime Institute of Biotechnology) and phosphatase and protease inhibitor cocktails (1 nM; MERCK). The total protein samples were 20 µg measured by BCA method. Then 10% SDS-PAGE (Yamei) electrophoresis, was performed and the proteins were transferred onto the polyvinylidene difluoride membrane. The strips were incubated with specific antibodies for iNOS (1:1000; Abcam, Cambridge, UK), SOCS3 (1:1000; Abcam, Cambridge, UK), STAT6 (1:1000; Abcam, Cambridge, UK) and p-STAT6 (1:1000; Abcam, Cambridge, UK) overnight at 4°C. β-actin (1:1000; ZSGB-BIO, Beijing, China) was used as the loading control. The next day, the membranes were washed three times with TBST, followed by a 1-h incubation with the secondary antibody (immunoglobulin G-horseradish peroxidase [IgG-HRP]; ZSGB-BIO, Beijing, China) at room temperature.The strips were placed on a colour developer (Tanon,China) for visual strip exposure with an ECL kit (Pufei Chemical Corp., Shanghai, China).
ELISA
The levels of IL-1β, IL-6, TNF-α, IL-4 and IL-10 secreted superfusates in the SC of mice (n = 3) and corresponding group of cell supernatants (BV2, HMC3; 6 h and 24 h) were determined using an ELISA kit. The collection, preservation and handling of specimens were in accordance with the instructions of the manufactures of the corresponding ELISA kits (mouse derived: 4A BIOTECH Beijing, human derived: Jianglaibio, Shanghai).
Statistical analyses
Statistical analyses the results for the pain thresholds of mice were performed. The PWL was calculated according to the observed standard deviation (SD) and yielded a sample size of n = 6 mice. Data were analyzed using GraphPad Prism version 8.0 (GraphPad Prism, 8.0.2, 263). The PWL in mice was determined by two-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparisons test, and one-way analysis of variance followed by Bonferroni’s multiple comparisons test was performed to analyze the expression of protein, mRNA and inflammatory cytokines (n = 3) in vivo and in vitro. The data were shown as mean ± SD. p < 0.05 was regarded as indicative of statistical significance. No data were transformed or excluded.
Ethical statement
Harbin Medical University Department of Anesthesiology, Affiliated Cancer Hospital proposes to conduct a research on CB2 receptor agonist AM1241 regulating the polarization of microglia reduces morphine tolerance through IL-4/STAT6 pathway.This project takes cell line and animal as the research subjects. HMU Medical Science Ethics Committee has examined the ethical issues involved in the project.
Results
The effect of AM1241 on markers of microglial polarization in vitro
Compared with that in the control group, LPS+Mor treatment increased the iNOS mRNA expression of microglia (BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p < 0.0001; 24 h, p < 0.0001) (Figure 1(a) and (c)). LPS+Mor treatment has no significant effect on SOCS3 mRNA expression in microglia relative to the control group (Figure 1(b) and (d)). LPS+Mor treatment group showed higher iNOS protein expression of microglia (BV2: 6 h, p = 0.0038; 24 h, p = 0.0002; HMC3: 6 h, p = 0.0026; 24 h, p < 0.0001) (Figure 1(g) and (i)) than the control group.
In the LPS+AM1241+Mor group, the level of iNOS mRNA was decreased (BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p < 0.0001; 24 h, p < 0.0001) (Figure 1(a) and 1(c)) compared with that in the LPS+Mor group. At the same time, the expression of SOCS3 mRNA was increased (BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p = 0.0002; 24 h, p < 0.0001) (Figure 1(b) and (d)). AM1241 pretreatment before morphine addition decreased the protein expression of iNOS (LPS+AM1241+Mor VS. LPS+Mor; BV2: 24 h, p = 0.0294; HMC3: 6 h, p = 0.0395; 24 h, p = 0.03) (Figure 1(g) and (i)) and increased SOCS3 protein expression (BV2: 6 h, p = 0.002; 24 h, p = 0.0094; HMC3: 6 h, p = 0.0265; 24 h, p = 0.0023) (Figure 1(h) and (j)).
There were no significant differences in the mRNA and protein expression of microglia between the LPS+ AM1241+Mor and LPS+AM281+AM1241+Mor groups (mRNA and protein of iNOS or SOCS3, all p > 0.0718). The CB2R antagonist AM630 reversed the effect of AM1241 on mRNA and protein expression of iNOS (mRNA: BV2: 6 h, p < 0.0001; 24 h, p = 0.0092; HMC3: 6 h, p = 0.0025; 24 h, p < 0.0001) (Figure 1(a) and 1(c)) (protein: BV2: 6 h, p = 0.0348; 24 h, p = 0.0155; HMC3: 6 h, p = 0.0384; 24 h, p = 0.0391) (Figure 1(g) and (i)) and SOCS3 (mRNA: BV2: 6 h, p < 0.0001; 24 h, p = 0.0041; HMC3: 6 h, p < 0.0001; 24 h, p < 0.0001) (Figure 1(b) and (d)) (protein: BV2: 6 h, p = 0.0022; 24 h, p = 0.0156; HMC3: 6 h, p = 0.0447; 24 h, p = 0.0031) (Figure 1(h) and (j)).
The effect of AM1241 on the expression of IL-4 and p-STAT6 in vitro
AM1241 treatment increased the level of IL-4 mRNA after morphine treatment in microglia (LPS+AM1241+Mor VS. LPS+Mor, BV2: 6 h, p = 0.0089, 24 h, p < 0.0001; HMC3: 6 h, p = 0.0012, 24 h, p = 0.0007) (Figure 2(c) and (g)). The level of p-STAT6 protein was increased by AM1241 in the LPS+AM1241+Mor group (LPS+AM1241+Mor VS. LPS+Mor, BV2: 6 h, p = 0.0023, 24 h, p = 0.0008; HMC3: 6 h, p = 0.015; 24 h, p = 0.0001) (Figure 2(m) and 3(c)). There was no significant differences in mRNA and protein expression of STAT6 between LPS+AM1241+Mor and LPS+Mor groups. The increased level of IL-4 mRNA in response to AM1241 treatment was decreased by IL-4I (LPS+IL-4I+AM1241+Mor VS. LPS+AM1241+Mor group) (Figures 2(d), (h), (n), and 3(d)), but there was no significant differences. IL-4I reversed the effect of AM1241 on p-STAT6 protein expression (LPS+IL-4I+AM1241+Mor VS. LPS+ AM1241+Mor group, BV2: 6 h, p = 0.0049; 24 h, p = 0.0145; HMC3: 6 h, p = 0.0135; 24 h, p = 0.0070) (Figures 2(m) and 3(c)). There was no difference between the LPS+IL-4I+AM1241+Mor group and LPS+AM1241+Mor group in regard to the mRNA and protein expression of STAT6.
The effect of IL-4I on AM1241-induced microglial polarization after morphine treatment in vitro
The iNOS mRNA expression was increased in the IL-4I treatment group (LPS+IL-4I+AM1241+Mor VS. LPS+ AM1241+Mor, BV2: 6 h, p = 0.0302; 24 h, p < 0.0001; HMC3: 6 h, p = 0.0001; 24 h, p = 0.0022) (Figure 2(a) and (e)). Compared with LPS+AM1241+Mor group, IL-4I decreased the SOCS3 mRNA expression induced by AM1241 in the LPS+IL-4I+AM1241+Mor group (BV2: 6 h, p < 0.0001; 24 h, p = 0.0002; HMC3: 6 h, p = 0.0057; 24 h, p < 0.0001 ) (Figure 2(b) and (f)).
The iNOS protein level was increased in the LPS+IL-4I+AM1241+Mor group relative to the LPS+AM1241+Mor group (BV2: 6 h, p = 0.0006; 24 h, p = 0.0304; HMC3: 6 h, p = 0.0025; 24 h, p = 0.0298) (Figures 2(k) and 3(a)). The effect of AM1241 on the expression of SOCS3 protein was also suppressed by IL-4I (LPS+IL-4I+AM1241+Mor VS. LPS+AM1241+Mor, BV2: 6 h, p < 0.0001; 24 h, p < 0.0001; HMC3: 6 h, p = 0.0435; 24 h, p = 0.0404) (Figures 2(l) and 3(b)).
The effect of AM1241 and IL-4I on the expression of cytokines in vitro
Morphine treatment increased the expression of pro-inflammatory cytokines (IL-1β, IL-6 and TNF-α) compared with that in the control group (LPS+Mor VS. control, BV2: IL-1β: 6 h, p < 0.0001; 24 h, p = 0.0005; IL-6: 6 h, p < 0.0001; 24 h, p < 0.0001; TNF-α: 6 h, p = 0.0002; 24 h, p = 0.0002, Figure 3(e)–(g); HMC3: IL-1β: 6 h, p = 0.0253; 24 h, p = 0.0025; IL-6: 6 h, p = 0.0207; 24 h, p = 0.0028; TNF-α: 6 h, p = 0.0002; 24 h, p = 0.0011, Figure 3(j)–(l)).
The LPS+AM1241+Mor group showed a lower level of pro-inflammatory cytokines (IL-1β, IL-6 and TNF-α) compared with the LPS+Mor group in BV2 cells (IL-1β: 6 h, p < 0.0001; 24 h, p = 0.0008; IL-6: 6 h, p < 0.0001; 24 h, p = 0.0057; TNF-α: 6 h, p = 0.0001; 24 h, p = 0.0005, Figure 3(e)–(g)) and HMC3 cells (IL-1β: 6 h, p = 0.0291; 24 h, p = 0.0164; IL-6: 6 h, p = 0.0474; 24 h, p = 0.0029; TNF-α: 24 h, p = 0.0042, Figure 3(j)–(l)). The effect of AM1241 on the pro-inflammatory cytokine levels (IL-1β, IL-6 and TNF-α) after morphine treatment was suppressed by IL-4I (LPS+AM1241+Mor VS. LPS+IL-4I+AM1241+Mor, BV2: IL-1β: 6 h, p < 0.0001; 24 h, p = 0.0387; IL-6: 6 h, p = 0.0004; 24 h, p = 0.0347; TNF-α: 6 h, p = 0.0005; 24 h, p = 0.0035, Figure 3(e)–(g); HMC3: IL-1β: 6 h, p = 0.0458; 24 h, p = 0.0238; IL-6: 6 h, p = 0.0744; 24 h, p = 0.0431; TNF-α: 24 h, p = 0.0259, Figure 3 (j)–(l)).
The expression of cytokines (IL-4 and IL-10) in the LPS+ AM1241+Mor group was higher than in the LPS+Mor group (BV2: IL-4: 6 h, p = 0.0007; 24 h, p < 0.0001; IL-10: 6 h, p = 0.0009; 24 h, p = 0.0064, Figure 3H, 3I; HMC3: IL-4: 6 h, p = 0.0259; 24 h, p < 0.0001; IL-10: 6 h, p = 0.0239; 24 h, p = 0.0083, Figure 3(m) and (n)). Compared with that in the LPS+AM1241+Mor group, the level of IL-10 in the LPS+IL-4I+AM1241+Mor group was decreased in BV2 cells (24 h, p = 0.0295, Figure 3(i)) and in HMC3 cells (24 h, p = 0.0015, Figure 3(n)). The level of IL-4 was not differ between the LPS+AM1241+Mor group and the LPS+IL-4I+AM1241+Mor group.
The effect of AM1241 on PWL in the morphine tolerance model
Compared with that in the VEH+SAL group, the value of PWL in the VEH+M10 group was higher on days 1 to 5 (day 1-4, p < 0.0001; day 5, p = 0.0057, Figure 4A). AM1241 treatment increased the PWL following chronic morphine administration after 4 days (AM1241+M10 VS. VEH+M10, day 4, p = 0.0454, day 5–7, p < 0.0001, Figure 4(a)). Pretreatment with AM630 but not AM281 reversed the effect of AM1241 on PWL after chronic morphine treatment.
The mice with morphine tolerance were evaluated via a subcutaneous injection of a single with 5 mg/kg dose of morphine on day 8. The PWL in the AM1241+M10+M5 group was significantly higher than that in the VEH+M10+M5 group at 30 min (p < 0.0001), 60 min (p < 0.0001), and 90 min (p = 0.0002). AM630 reversed the effect of AM1241 on morphine tolerance (30 min, p = 0.0225) (Figure 4(b)).
The effect of AM1241 on microglial polarizationin in the morphine tolerance model
Chronic morphine treatment increased the mRNA and protein expression of iNOS (VEH+M10+M5 VS. VEH+SAL+ SAL, both p < 0.0001, Figure 4(c) and (f)). AM1241 treatment decreased the mRNA and protein expression of iNOS (both p < 0.0001, Figure 4(c) and (f)) and increased the mRNA and protein levels of SOCS3 compared with those in the VEH+M10+M5 group (both p < 0.0001, Figure 4(d) and (g)). There was no significant differences in the expression of iNOS and SOCS3 between the AM281+AM1241+M10+ M5 group and the AM1241+M10+M5 group, but the effect of AM1241 was revered by AM630.
The effect of AM1241 on the expression of IL-4 and p-STAT6 in the morphine tolerance model
The AM1241+M10+M5 group showed a higher level of IL-4 mRNA expression than the VEH+M10+M5 group on IL-4 (p < 0.0001, Figure 5(e)). Compared with the VEH+M10+M5 group, the AM1241+M10+M5 group had a higher level of p-STAT6 protein expression in response to AM1241 (p = 0.0393, Figure 5(j)). AM1241 did not play a significant role in the differential expression of STAT6 mRNA and protein between the AM1241+M10+M5 group and the VEH+M10+M5 group (Figure 5(f) and (k)).
The effect of IL-4I on PWL, p-STAT6 expression and microglial polarization after AM1241 treatment in the morphine tolerance model
IL-4I attenuated the inhibitory effect of AM1241 on morphine tolerance. The PWL was decreased in the IL-4I+ AM1241+M10 group after day 2 compared with that in tje AM1241+M10 group (all p < 0.0063). The PWL in IL-4I+AM1241+M10 group was similar to that in the VEH+M10 group. In the IL-4I+AM1241+M10 group, the values of PWL on days 2 to 7 were lower than on day 1 (all p < 0.0009, Figure 5(a)).
On day 8, in the group administered of 5 mg/kg morphine alone, the PWL was significantly high at 30 min, 60 min, 90 min and 120 min (VEH+SAL+M5 VS. VEH+SAL+ SAL, all p < 0.0001, Figure 5(a)). Compared with that in the AM1241+M10+M5 group, the value of PWL in the IL-4I+AM1241+M10+M5 group showed a lower level at 30 min (p =0.0009, Figure 5(b)).
Compared with that in the AM1241+M10+M5 group, the expression of p-STAT6 protein was decreased in the IL-4I+AM1241+M10+M5 group (p =0.0141, Figure 5(j)). IL-4I administration did not affect the mRNA and protein expression of STAT6. IL-4I treatment activated the expression of iNOS mRNA (p =0.0109, Figure 5(c)) and inhibited the SOCS3 mRNA expression (p =0.0026, Figure 5(d)) in the IL-4I+AM1241+M10+M5 group compared with that in the AM1241+M10+M5 group. The iNOS protein in the AM1241+M10+M5 group showed a lower level than that in the IL-4I+AM1241+M10+M5 group (p =0.0036, Figure 5(h)). The effect of AM1241 on the expression of SOCS3 protein was also inhibited by IL-4I (p < 0.0001, Figure 5(i)).
The effect of AM1241 and IL-4I on cytokines in morphine tolerance model
The level of pro-inflammatory cytokines was increased after morphine chronic injection (VEH+M10+M5 VS. VEH+ SAL+SAL, IL-1β, p = 0.0008; IL-6 and TNF-α, p < 0.0001, Figure 5(l)–(n)). There was no significant difference in IL-4 and IL-10 expression between the VEH+M10+M5 group and the VEH+SAL+SAL group.
AM1241 had a suppressive effect on the morphine induced expression of pro-inflammatory cytokines such as IL-1β, IL-6 and TNF-α (AM1241+M10+M5 VS. VEH+ M10+M5, IL-1β, p = 0.0009; IL-6 and TNF-α, p < 0.0001, Figure 5(l)–(n)). The levels of IL-4 and IL-10 were increased by AM1241 in the AM1241+M10+M5 group (p < 0.0001, Figure 5(o) and (p)). Upon coadministration with IL-4I, the effect of AM1241 on pro-inflammatory cytokines such as IL-1β, IL-6 and TNF-α was suppressed by IL-4I (IL-4I+ AM1241+M10+M5 VS. AM1241+M10+M5, IL-1β, p = 0.0018; IL-6, p = 0.0005; TNF-α, p = 0.0047, Figure 5(l)–(n)), and IL-4I decreased the expression of IL-10 (p < 0.0001, Figure 5(p)). IL-4I itself did not have much influence on the AM1241-induced expression.
Discussion
We found that (1) morphine treatment increased the iNOS mRNA and protein levels of microglia in vitro and vivo. (2) The CB2R agonist AM1241 heightened morphine analgesia and ameliorated tolerance in mice. (3) AM1241 treatment downregulated mRNA and protein expression of the M1 marker iNOS and upregulated the mRNA and protein levels of M2 marker SOCS3 after chronic morphine treatment both in vitro and vivo. (4) AM1241 increased the IL-4 mRNA and the p-STAT6 protein expression. (5) IL-4I inhibition the effect of AM1241 on IL-4 mRNA, p-STAT6 protein and pro-inflammatory cytokines secretion in our study. These findings suggested that AM1241 positively regulates the IL-4/STAT6 pathway, mediating microglial polarization in reaction to morphine tolerance.
The value of PWL decreased significantly after 7 days of continuous morphine injection in mice of morphine tolerance. This suggests that the mice developed morphine tolerance. AM1241 could enhance the threshold of PWL after day 4 with chronic morphine treatment, which suggested that AM1241 attenuates morphine tolerance. This result shows that the CB2R agonist AM1241 is beneficial for morphine tolerance, which is consistent with previous findings.1,2
IL-1 receptor antagonist has been shown to reduce tolerance in previous studies. Blocking of IL-1β signaling with drugs could also block the development of morphine tolerance. 29 Inflammatory cytokines are secreted mainly by activated microglia in the CNS. Microglia originated in the macrophage domain and have two distinct activation states, namely, the classical activation state M1 as a proinflammatory state, and the M2 state related to repair function. 30
In response to stimulation with different substances, microglia enter different polarization states. When LPS or interferon gamma (IFN-γ) triggers classical activation, microglia secrete multiple proinflammatory substances (such as IL-1β, IL-6, and TNF-α) under the M1 proinflammatory phenotype, resulting in neurotoxicity. 31 Morphine injection induced an increase in the mRNA and protein levels of the M1 marker iNOS, and may therefore increase the secretion of pro-inflammatory substances in vitro and in morphine tolerant mice. These results suggest that the polarization of microglia towards the M1 phenotype contributed to morphine tolerance, which was consistent with previous results.32,33
AM1241, a specific CB2R agonist, has been attracted widespread attention owing to its anti-inflammatory properties. CB2R expression is up-regulated in morphine tolerance models. 3 Previous studies have reported that a CB2R agonist reduced the M1 polarization of microglia and induced microglia to polarize in the M2 direction, alleviating inflammation-related responses and exerting anti-inflammatory effects in a germinal matrix hemorrhage rat model and PD.34,35 In our current study, AM1241 reduced the expression of M1 maker iNOS and increased the M2 marker of SOCS3 expression after morphine treatment in vitro and in the morphine tolerance mouse model. These findings indicated that AM1241 could not only inhibit the M1 phenotype polarization of microglia, but also induce microglia to polarize towards the M2 phenotype. Polarization bias of microglia leads to a change in the expression of the corresponding pro/anti-inflammatory substances. Therefore, the effect of the CB2R agonist AM1241 on morphine tolerance may be not only due to a decrease in M1 related pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, but also an increase in M2-related anti-inflammatory cytokines IL-4 and IL-10.
IL-4, as a known immune-suppressive stimulant of the M2-macrophage subtype, could induce microglia to polarize toward the M2 phenotype via activation of the STAT6 signaling pathway.36,37 In a traumatic spinal cord injury model, microglial polarization toward the M2 phenotype is dependent on IL-4 signaling. 38 In addition, previous studies have reported that microglia tend to undergo M2-polarization through the IL-4/STAT6 dependent pathway in inflammation-related diseases. 39
We observed no significant differences in the IL-4 mRNA and p-STAT6 protein levels after morphine treatment relative to the control group in this study. However, IL-4 mRNA and p-STAT6 protein levels increased following AM1241 administration after chronic morphine treatment, while the mRNA and protein levels of SOCS3 increased after AM1241 treatment. Notably, IL-4I (IL-4 inhibitor) partially inhibited the elevation of SOCS3 and p-STAT6 protein levels induced by AM1241, suggesting that IL-4I exerts a partial antagonistic effect on the action of AM1241.These results suggest that AM1241 may induce microglial polarization to M2 after morphine treatment via the IL-4/STAT6 pathway.
There are some shortcomings to this study. First, although microglia have several phenotypically associated proteins, we examined only one. Second, the expression of iNOS and SOCS3 protein and mRNA were detected only at one point in time on the 8th day, and the expression of iNOS and SOCS3 was not detected at other time points. Third, this study primarily examined tolerance - associated gene expression levels but did not explore their dynamic changes. Further studies are needed to address these limitations.
Conclusion
In summary, in the present study, we identified that chronic morphine treatment caused microglia to polarize to the M1 state, which is related to morphine tolerance. AM1241 alleviated morphine tolerance by inhibiting the polarization of microglia to the M1 state and inducing microglial to the M2 phenotype, which may occur through IL-4/p-STAT6 pathway. Microglial polarization plays an important role in morphine tolerance; thus, targeting the conversion of microglia to the M2 state may provide a novel means to prevent tolerance to the analgesic effect of opioids.
Acknowledgements
We would like to express our sincere gratitude to Harbin Medical University Cancer Hospital for providing the Haiyan Scientific Research Fund (no. JJMS 2022-11) to support this research. We are also deeply thankful for the Fundamental Research Funds for the Provincial Universities (2023-KYYWF-0210) for their financial support. Without these funds, this study would not have been possible. We also want to extend our appreciation to all the colleagues and institutions that have contributed to this research in various ways.