Complex Patterns of Cannabinoid Alkyl Side-Chain Inheritance in Cannabis.

Abstract

The cannabinoid alkyl side-chain represents an important pharmacophore, where genetic targeting of alkyl homologs has the potential to provide enhanced forms of Cannabis for biopharmaceutical manufacture. Delta(9)-tetrahydrocannabinolic acid (THCA) and cannabidiolic acid (CBDA) synthase genes govern dicyclic (CBDA) and tricyclic (THCA) cannabinoid composition. However, the inheritance of alkyl side-chain length has not been resolved, and few studies have investigated the contributions and interactions between cannabinoid synthesis pathway loci. To examine the inheritance of chemical phenotype (chemotype), THCAS and CBDAS genotypes were scored and alkyl cannabinoid segregation analysed in 210 F₂ progeny derived from a cross between two Cannabis chemotypes divergent for alkyl and cyclic cannabinoids. Inheritance patterns of F₂ progeny were non-Gaussian and deviated from Mendelian expectations. However, discrete alkyl cannabinoid segregation patterns consistent with digenic as well as epistatic modes of inheritance were observed among F₂ THCAS and CBDAS genotypes. These results suggest linkage between cannabinoid pathway loci and highlight the need for further detailed characterisation of cannabinoid inheritance to facilitate metabolic engineering of chemically elite germplasm.

Untitled section

Subject terms: Biologics, Secondary metabolism, Natural variation in plants

Article notes

Untitled section

Received 2019 May 31; Accepted 2019 Jul 24; Collection date 2019.

Author notes

Introduction

Cannabis is a phylogeographically divergent¹ notably heterozygote² anemophilous (wind pollinated) angiosperm genus³, which has undergone sub-selection for fibre, seed⁴, recreational drug, and medical end-uses^5,6. Despite a long history of domestication dating back several thousand years⁷, exploitation of Cannabis ex situ genetic resources using modern improvement strategies has been hampered due to legal constraints relating to the plant’s status as a narcotic⁸.

Cannabis plants produce a class of therapeutically important isoprenylated resorcinyl polyketides⁹, more commonly identified as (phyto)cannabinoids¹⁰. These accumulate predominantly within capitate stalked trichromes on floral tissues¹¹. Cannabinoids are synthesised with a carboxylated resorcinyl core, which readily decarboxylates by non-enzymatic means¹². Structurally, cannabinoids vary by isoprenyl topological arrangement¹³, of which dicyclic cannabidiol (CBD)-type and tricyclic delta(9)-tetrahydrocannabinol (THC)-type cannabinoids are commonly encountered in planta¹⁴. Another important structural feature of cannabinoids is the resorcinyl alkyl side-chain which typically occurs in either pentyl (C₅) or to a lesser extent propyl (C₃) configuration^15,16, although a variety of odd and even carbon lengths have been reported as minor constituents in a subset of germplasm^17,18.

The G-protein-coupled cannabinoid type 1 (CB₁R) and 2 (CB₂R) receptors are principally implicated in mediating biological effects of the human endocannabinoid system, a complex aggregate of several therapeutic targets, multiple signalling pathways and ion channels^19,20. The pro-homeostatic functionality of the endocannabinoid system is thought to stem from its secretory regulation of signalling molecules²⁰, namely various neurotransmitters (e.g. 5-HT and GABA)^21,22 and cytokines (e.g. TNF-α and IL-17)^23,24. Associated neuro-immunomodulatory activity by exogenous cannabinoid ligands appear beneficial in a myriad of seemingly unrelated indications, ranging from the treatment of seizures in refractory paediatric epilepsies (Epidiolex^®)²⁵ through to chronic pain in advanced cancer patients (Nabiximols)²⁶. Structure-activity relationship studies have identified the resorcinyl alkyl group as a critical pharmacophoric element^27,28. Elongation of the carbon side-chain increases cannabinoid receptor binding affinity^29,30, with pharmacological potency of C₄ to C₈ alkyl chain homologs showing systematic increases up to 29-fold³⁰. Despite the potential for metabolic engineering of the alkyl group for in planta therapeutic cannabinoid portfolio expansion^15,31, uncertainty over the genetic and biosynthetic regulation of alkyl cannabinoid homology hinders the development of novel recombinant cannabinoid breeding lines for biopharmaceutical exploitation.

The cannabinoid structural motif is generated from substrates originating from two independent biosynthetic pathways. Aromatic prenylation of geranyl diphosphate (GPP) and a phenolic alkylresorcinolic acid intermediate form monocyclic cannabinoids that feature a linear isoprenyl residue (e.g. cannabigerolic acid (CBGA))^32,33. Chain length of the alkylresorcinol fatty acid (FA) starter unit is thought to determine alkyl cannabinoid homology^34,35. This hypothesis has been supported using a synthetic cell-free enzymatic platform which produced the propyl-cannabinoid intermediate cannabigerovarinic acid (CBGVA) from a C₃ alkylresorcinol substrate (divarinic acid)³⁶. In vivo production of CBGVA and divarinic acid as well as associated end products delta(9)-tetrahydrocannabivarinic acid (THCVA) and cannabidivarinic acid (CBDVA) have also recently been reported in engineered yeast strains fed the predicted C₃ alkyl cannabinoid intermediate butanoyl-CoA³⁷. However, resolution of associated in planta biosynthetic pathways has largely focused on C₅ alkyl species^33,38.

Cannabidiolic acid synthase (CBDAS) and delta(9)-tetrahydrocannabinolic acid synthase (THCAS) perform stereoselective oxidative cyclisation of the isoprenyl moiety, forming dicyclic and tricyclic cannabinoids. Physical and genetic mapping of THCAS and CBDAS genes has recently allowed for alignment of genetic loci to resolve the cluster of closely-linked genes. These genomic regions appeared abundant with retrotransposable elements as well as pseudogenic tandem repeats, and their positions have been assigned within a larger low recombining pericentromeric gene-poor region^39,40. Regions also appeared non-homologous between chemotypes which suggests significant divergence between chemotypic lineages, although the reported hemizygosity for THCAS and CBDAS may be an artefact of genome assembly due to the underlying complexity of this region^39,40. While the presence of tandem THCAS as well as CBDAS arrays would imply oligogenic inheritance, genepool representative germplasm segregate in a 1:2:1 dicyclic: tricyclic cannabinoid ratio characteristic of a single codominant locus B model^41,42. This suggests cannabinoid synthase tandem arrays may include functionally superfluous repeats which seldom recombine, that although separated in terms of physical distance (>1 Mbp)⁴⁰, segregate in a manner that resembles mutually exclusive B_THCAS (THCAS) and B_CBDAS (CBDAS) alleles.

The dioecious reproduction of Cannabis often confounds genetic analysis. Previous analysis of tricyclic chemotypes segregating for alkyl cannabinoid composition inferred a multiple locus A¹-A²-… Aⁿ model, whereby alleles A_pr¹⁻ⁿ and A_pe¹⁻ⁿ with additive effect govern the proportion of alkyl cannabinoid homologs³¹. However, chemotypic continuity of the available progeny precluded demarcation of categories, thereby preventing chi-square analysis to resolve the inheritance model. To examine alkyl cannabinoid loci and determine their allelic assortment with cannabinoid synthase genes, we analysed a population segregating for alkyl and cyclic cannabinoid composition. Biparental reciprocal crosses between chemotypes divergent for alkyl and cyclic cannabinoids were performed, generating F₁ hybrid families. A single F₂ generation derived from an F₁ male and female cross was developed for chemotypic segregation analysis. Cannabinoid profiling of F₂ progeny along with genotypic analysis using a THCAS- and CBDAS-specific DNA sequence characterised amplified region (SCAR) marker assay was conducted to investigate interactions between cannabinoid pathway loci. Frequency distributions were determined using kernel density estimation, a statistical method of applying smoothing to a frequency histogram⁴³. Kernel density was used to estimate underlying distributions and to demarcate chemotypes objectively into categories, thereby exposing modes of inheritance for alkyl side-chain length.

Results

Parental selection

Juvenile plants of three parental lines were screened for cannabinoid composition. C₃/C₅ alkyl cannabinoid fractions (F_C3/F_C5) associated with alkyl cannabinoid loci (Aⁿ loci) as well as di-/tri-cyclic cannabinoid fractions (F_dicyclic/F_tricyclic) associated with the B locus complex were determined from the fresh weight (w/w) cannabinoid content of CBDVA, THCVA, cannabidiolic acid (CBDA) and delta(9)-tetrahydrocannabinolic acid (THCA). Eight individual plants which exhibited either [high F_C3 + F_tricyclic (e.g. THCVA)] or [high F_C5 + F_dicyclic (e.g. CBDA)] cannabinoid chemotypes were tentatively assigned homozygote status at the A and B locus complexes (Table 1). These plants from accessions EIO.MW15.P (n = 4), EIO.MW15.T (n = 2) and EIO.MW17.X (n = 2) were selected as parents to generate two biparental reciprocal crosses, forming four F₁ hybrid families (Fig. 1). Parents of F₁ hybrid family EIO.MW17.Y1 exhibited the largest divergence in F_C3 (Table 1). To further examine parental homozygosity in this lineage, P1 (EIO.MW15.P [07]) and P2 (EIO.MW15.T [02]) were scored using a codominant locus B DNA sequence characterised amplified region (SCAR) marker assay. As expected, P1 and P2 had a marker genotype homozygote for THCAS (B_THCASB_THCAS) and homozygote CBDAS (B_CBDASB_CBDAS), respectively.

Table 1Experimental populations and chemotypic segregation between tricyclic C₃ alkyl (THCVA) and dicyclic C₅ alkyl (CBDA) Cannabis plants.

Cross	Generation	n	Sample ID	F_C3 (% total)	F_dicyclic (% total)
EIO.MW15.P x EIO.MW15.T	P1	22	EIO.MW15.P [07]	69.8–92.9 [88.3]	0.1–2.0 [0.9]
	P2	18	EIO.MW15.T [02]	0.5–1.0 [0.8]	60.9–96.2 [96.1]
	F_I	35	EIO.MW17.Y1 [15, 32]	24.3–56.0 [35.5, 24.3]	49.5–75.8 [62.2, 75.8]
	F₂	210	EIO.MW18.Z	0.7–88.0	0.1–95.9
EIO.MW15.T x EIO.MW15.P	P1	18	EIO.MW15.T [04]	0.5–1.0 [0.8]	60.9–96.2 [95.0]
	P2	22	EIO.MW15.P [11]	69.8–92.9 [83.9]	0.1–2.0 [0.4]
	F_I	34	EIO.MW17.Y2	7.4–42.3	48.0–74.8
EIO.MW17.X x EIO.MW15.P	P1	13	EIO.MW17.X [05]	0.8–1.2 [0.9]	93.7–96.5 [95.7]
	P2	22	EIO.MW15.P [18]	69.8–92.9 [86.8]	0.1–2.0 [1.3]
	F_I	16	EIO.MW17.Y3	25.0–64.8	56.2–66.2
EIO.MW15.P x EIO.MW17.X	P1	22	EIO.MW15.P [03]	69.8–92.9 [87.2]	0.1–2.0 [0.3]
	P2	13	EIO.MW17.X [12]	0.8–1.2 [0.9]	93.7–96.5 [96.5]
	F_I	27	EIO.MW17.Y4	28.5–73.3	26.2–70.8

Schematic diagram of filial generations. Parental breeding lines were screened for cannabinoid composition and eight plants high in either FC3 as well as Ftricyclic or FC5 as well as Fdicyclic values served as parents for two biparental reciprocal crosses, generating four F1 hybrid families. A single male and female plant from the F1 hybrid family which demonstrated the highest level of FC3/FC5 homogeneity served as parents of an F2 population segregating for FC3/FC5 and Fdicyclic/Ftricyclic cannabinoid composition. C5 alkyl cannabinoid fraction (FC5); C3 alkyl cannabinoid fraction (FC3); dicyclic cannabinoid fraction (Fdicyclic); and tricyclic cannabinoid fraction (Ftricyclic). — Figure 1Schematic diagram of filial generations. Parental breeding lines were screened for cannabinoid composition and eight plants high in either F_C3 as well as F_tricyclic or F_C5 as well as F_dicyclic values served as parents for two biparental reciprocal crosses, generating four F₁ hybrid families. A single male and female plant from the F₁ hybrid family which demonstrated the highest level of F_C3/F_C5 homogeneity served as parents of an F₂ population segregating for F_C3/F_C5 and F_dicyclic/F_tricyclic cannabinoid composition. C₅ alkyl cannabinoid fraction (F_C5); C₃ alkyl cannabinoid fraction (F_C3); dicyclic cannabinoid fraction (F_dicyclic); and tricyclic cannabinoid fraction (F_tricyclic).

F₁ hybrid chemotypic uniformity

F₁ individuals across all four hybrid families appeared chemotypically intermediate to the parents, although F_C3/F_C5 as well as F_dicyclic/F_tricyclic distribution patterns were not uniform between families (Fig. 2a). No consistent maternal or paternal patterns of inheritance were observed for F_C3 values among the reciprocal crosses. However, discrete lineage-specific chemotypic distribution patterns were evident, with F₁ hybrid families (EIO.MW17.Y1, EIO.MW17.Y2) from EIO.MW15.T parents displaying cannabinoid composition skewed towards high F_C5 as well as F_dicyclic values (CBDA) (Fig. 2a,b). Individuals within hybrid families displayed transgressive segregation for a subset of cannabinoids. CBDVA and THCA proportions (%/total) were greater than parent values, with CBDVA increasing by more than 20-fold (Fig. 2b). F_C3/F_C5 variance differed between the four F₁ hybrid families (Table 2), with plants from EIO.MW17.Y1 having the least (Table 2). This, along with the B locus homozygote genotypes of EIO.MW17.Y1 parents, was interpreted as an indication of P1 and P2 homozygosity at the A locus complex. Single male and female plants of EIO.MW17.Y1 were crossed and alkyl cannabinoid segregation assessed in the resulting F₂ generation (Fig. 1).

Chemotypic distributions of four F1 hybrid families. (a) Chemotypic distribution patterns of dicyclic and C3 alkyl cannabinoid composition within the total cannabinoid fraction. F1 chemotypes are intermediate to the parents, although discrete linage-specific distribution patterns are evident between families. (b) Compositional range of cannabinoids from individual plants within F1 hybrid families. Blue squares represent chemotypes of individual plants within F1 families; Blue circles represent cannabinoid composition of individual plants within F1 families; Red diamond represent female parent (P1); Black triangle represent male parent (P2); C3 alkyl cannabinoid fraction (FC3); dicyclic cannabinoid fraction (Fdicyclic). — Figure 2Chemotypic distributions of four F₁ hybrid families. (a) Chemotypic distribution patterns of dicyclic and C₃ alkyl cannabinoid composition within the total cannabinoid fraction. F₁ chemotypes are intermediate to the parents, although discrete linage-specific distribution patterns are evident between families. (b) Compositional range of cannabinoids from individual plants within F₁ hybrid families. *Blue squares* represent chemotypes of individual plants within F₁ families; *Blue circles* represent cannabinoid composition of individual plants within F₁ families; *Red diamond* represent female parent (P₁); *Black triangle* represent male parent (P₂); C₃ alkyl cannabinoid fraction (F_C3); dicyclic cannabinoid fraction (F_dicyclic).

Table 2Homogeneity of variances for four hybrid F₁ families segregating for alkyl cannabinoid composition.

F₁ family	Variance (F_C3)	df
EIO.MW17.Y1	44.8^a	34
EIO.MW17.Y2	160.4^a,b	33
EIO.MW17.Y3	185.2^a,b	15
EIO.MW17.Y4	138.0^a,b	26

Inheritance patterns of the F₂ progeny

A continuous distribution of F_C3/F_C5 values was observed among the F₂ progeny (Fig. 3a,b). To minimise classification error, kernel density estimates (KDE) were used to categorise individual plants objectively prior to testing the fit of genetic models. F_C3/F_C5 values for the F₂ population were non-Gaussian and instead formed discrete pentapartite distributions. F_C3/F_C5 values were skewed towards low F_C3 and deviated significantly from the expected 1:4:6:4:1 chemotypic segregation ratio (Fig. 3a, Table 3). KDE of F_dicyclic/F_tricyclic values formed a predominantly tripartite distribution quasi-compatible with incomplete dominance and a 1:2:1 segregation ratio (Fig. 3b). However, discrete distributions embedded within the intermediate F_dicyclic/F_tricyclic chemotypes suggested the possibility of additional F_dicyclic/F_tricyclic categorises (Fig. 3b). The F_dicyclic/F_tricyclic intermediate chemotypic distribution was skewed towards high F_dicyclic and diverged significantly from the mid-parent F_dicyclic value of 48.5 (Fig. 3b). The continuous distribution of F_dicyclic intermediate and high F_dicyclic values also prevented accurate dissection of inclusion/exclusion boundaries for chemotypic frequency estimation (Fig. 3b).

Chemotypic distribution patterns of F2 progeny segregating for cyclic and alkyl cannabinoid composition. (a) Kernel density estimates of FC3 values showing a pentapartite alkyl cannabinoid distribution. (b) Kernel density estimates of Fdicyclic values showing a predominantly tripartite cyclic cannabinoid distribution. Grid reference points for kernel density estimates for FC3 as well as Fdicyclic values are shown on the x-axes. For FC3 values, frequency distributions are skewed towards low FC3. The intermediate Fdicyclic distribution deviates from the mid-parent value of 48.5 and is skewed towards high Fdicyclic. Red line indicates Fdicyclic mid-parent value; C3 alkyl cannabinoid fraction (FC3); dicyclic cannabinoid fraction (Fdicyclic). — Figure 3Chemotypic distribution patterns of F₂ progeny segregating for cyclic and alkyl cannabinoid composition. (a) Kernel density estimates of F_C3 values showing a pentapartite alkyl cannabinoid distribution. (b) Kernel density estimates of F_dicyclic values showing a predominantly tripartite cyclic cannabinoid distribution. Grid reference points for kernel density estimates for F_C3 as well as F_dicyclic values are shown on the x-axes. For F_C3 values, frequency distributions are skewed towards low F_C3. The intermediate F_dicyclic distribution deviates from the mid-parent value of 48.5 and is skewed towards high F_dicyclic. *Red line* indicates F_dicyclic mid-parent value; C₃ alkyl cannabinoid fraction (F_C3); dicyclic cannabinoid fraction (F_dicyclic).

Table 3Goodness-of-fit tests for alkyl cannabinoid chemotypic segregation ratios.

F₂ population	F_C3 categorisation (low – high)						Model		Goodness-of-fit
Genotype	n	I	II	III	IV	V	No. loci	Gene effect	Expected ratio	χ²	df	Critical value^a	H₀ accepted
All	210	92	33	33	21	31	2	Additive	1:4:6:4:1	551.07	4	9.49	No
B _CBDAS B _CBDAS	44	26	6	7	5	—	2	Dominant	9:3:3:1	2.71	3	7.82	Yes
B _THCAS B _CBDAS	116	44	42	9	21	—	2	Dominant	9:3:3:1	59.33	3	7.82	No
B _THCAS B _THCAS	50	21	22	7	—	—	2	Dominant,partially dominant	7:6:3	1.20	2	5.99	Yes

Locus B genotype-specific alkyl cannabinoid distributions

To resolve F_dicyclic/F_tricyclic chemotypic categories, the F₂ progeny and F₁ parents were genotyped for F_dicyclic (CBDAS) F_tricyclic (THCAS) associated alleles using the locus B DNA SCAR marker assay. The F₁ parents had the predicted heterozygote THCAS CBDAS (B_THCASB_CBDAS) genotypes. Genotypes B_CBDASB_CBDAS, B_THCASB_CBDAS and B_THCASB_THCAS, were consistent with the F_dicyclic/F_tricyclic chemotype distributions in the F₂ progeny (Fig. 4a). On the basis of genotypic frequency, a segregation ratio of 1:2:1 (low, intermediate and high F_dicyclic) characteristic of a codominant monogenic model was accepted (χ² = 2.65; threshold for accepting H₀ at P = 0.05 is 5.99).

Locus B genotype-specific alkyl cannabinoid distribution patterns within F2 progeny. (a) Cyclic and alkyl cannabinoid inheritance patterns associated with locus B genotypes. (b) Kernel density estimates for homozygote BCBDASBCBDAS genotypes. (c) Kernel density estimates for heterozygote BTHCASBCBDAS genotypes. (d) Kernel density estimates for homozygote BTHCASBTHCAS genotypes. Comparison of Fdicyclic values on the y-axes and FC3 values on the x-axes in Fig. 4a reveal three divergent FC3 inheritance patterns. Locus B genotypes are consistent with Fdicyclic values. C3-alkyl cannabinoid fraction (FC3); dicyclic cannabinoid fraction (Fdicyclic); locus B genotypes: homozygote THCAS (BTHCASBTHCAS), homozygote CBDAS (BCBDASBCBDAS), heterozygote THCAS CBDAS (BTHCASBCBDAS). — Figure 4Locus B genotype-specific alkyl cannabinoid distribution patterns within F₂ progeny. (a) Cyclic and alkyl cannabinoid inheritance patterns associated with locus B genotypes. (b) Kernel density estimates for homozygote B_CBDASB_CBDAS genotypes. (c) Kernel density estimates for heterozygote B_THCASB_CBDAS genotypes. (d) Kernel density estimates for homozygote B_THCASB_THCAS genotypes. Comparison of F_dicyclic values on the y-axes and F_C3 values on the x-axes in Fig. 4a reveal three divergent F_C3 inheritance patterns. Locus B genotypes are consistent with F_dicyclic values. C₃-alkyl cannabinoid fraction (F_C3); dicyclic cannabinoid fraction (F_dicyclic); locus B genotypes: homozygote *THCAS* (B_THCASB_THCAS), homozygote *CBDAS* (B_CBDASB_CBDAS), heterozygote *THCAS CBDAS* (B_THCASB_CBDAS).

Analysis of F_C3/F_C5 values within locus B genotypes revealed B_CBDASB_CBDAS-, B_THCASB_CBDAS- and B_THCASB_THCAS-specific distribution patterns (Fig. 4a–d, Supplementary Fig. S1). For B_CBDASB_CBDAS and B_THCASB_CBDAS genotypes, quadripartite distributions could be discerned from F_C3/F_C5 values (Fig. 4b,c). The most obvious deviation from the F₂ F_C3/F_C5 distribution pattern was observed in the B_THCASB_THCAS genotypes, with KDE describing a tripartite distribution (Fig. 4d). Analogous with the complete F₂ population (Fig. 3a), B_THCASB_CBDAS genotypes had a F_C3/F_C5 chemotype distribution resembling a composite of locus B homozygote inheritance patterns (Fig. 4b–d).

Given the high frequency of F_C3 minima chemotypes among the F₂ progeny (Figs 3a, 4b–d), complete dominance at one or more A gene pair locus was considered plausible for F_C3/F_C5 inheritance. Epistasis was also evaluated for locus B genotype-specific F_C3/F_C5 segregation ratios due to their non-conformity with Mendelian expectations. For the B_CBDASB_CBDAS-specific F_C3/F_C5 quadripartite distribution pattern, a segregation ratio of 9:3:3:1 was accepted in support of a digenic model describing two independent Mendelian loci (Table 3). The B_THCASB_THCAS-specific tripartite F_C3/F_C5 distribution conformed to a 7:6:3 segregation ratio, and an epistatic model describing dominance at one gene pair and partial dominance at the alternative gene pair was accepted (Table 3). A 9:3:3:1 segregation ratio was not supported by the B_THCASB_CBDAS-specific F_C3/F_C5 values. Given the quadripartite nature of B_THCASB_CBDAS-specific F_C3/F_C5 distributions, a 7:6:3 segregation ratio could not be tested (Table 3). B_THCASB_CBDAS-specific F_C3 categories I, II and IV did, however, share similar relative frequency and F_C3/F_C5 spacial distribution as the B_THCASB_THCAS-specific categories (Table 3, Fig. 4c,d).

Discussion

The contiguous pentapartite distributions in the F₂ generation for F_C3/F_C5 values were not consistent with a polygenic binomial inheritance pattern. Quantitative characters are not exclusive to polygenic modes of inheritance^44,45. Simple Mendelian inheritance can result in phenotypic continuity when within-genotypic class variation is large and average phenotypic differences between genotypes are negligible⁴⁵. Given that alkyl-cannabinoid loci are associated with enzymatic reactions which are several biosynthetic steps upstream of the metabolites used for chemotypic assessment^46,47, there is potential for intracellular biophysical interactions affecting the channelling and metabolic flux of pathway intermediates. Formation of multienzyme complexes has been implicated in altering isoprenoid production in Arabidopsis thaliana due to physical interactions between geranylgeranyl diphosphate (GGPP) synthase and downstream GGPP-consuming enzymes⁴⁸. These interactions could affect the expression of alkyl cannabinoids and contribute to the continuous variation in chemotype values observed in filial populations.

The multi-model segregation pattern within the F₂ progeny did not support a monogenic model, and so digenic inheritance was considered (Fig. 3a). In a digenic model with additive effects, a segregation ratio of 1:4:6:4:1 is expected⁴⁹. However, F_C3/F_C5 values were skewed towards the F_C3 minima parent and a disproportionate number of progeny segregated in the F_C3 minima category (Fig. 3a, Table 3). Unequal additive effects at different loci associated with the alkyl cannabinoid pathway, combined with aggregation of trigenic heptapartite categories may also have contributed to an F₂ chemotype segregation skewed towards the F_C3 minima parent, although the frequency of F_C3 maxima progeny in category V clearly exceeds the 1/64 allowed by this model (Table 3).

The inheritance of phenotypic traits can be additive or non-additive⁵⁰. If the inheritance of genes indicates an additive effect, the hybrid phenotype will tend to reflect the average effect of the parent genes or midparent value (MPV)^50,51. Phenotypic traits which deviate from the MPV in hybrid progeny are assumed to be inherited in a non-additive manor^45,50, and inheritance can be attributed to dominant or epistatic gene effects⁵². Alkyl cannabinoid proportions within F₁ family EIO.MW17.Y1, from which the F₂ generation was derived, showed a negative median deviation from the MPV (44.6% F_C3), with hybrid progeny displaying a median F_C3 value of 35.1 (±6.7 s.d.) (range 24.3–56.0) % (Fig. 2a). Incomplete dominance and/or epistasis may therefore explain the deviation of EIO.MW17.Y1 chemotypes towards the F_C3 minima parent (Fig. 2a). A non-additive model may also explain the higher frequency of F_C3 minima progeny observed in the F₂ generation (Fig. 3a).

Single seed descent F₈ recombinant inbred lines as well as doubled haploid lines can achieve more than 99.7% homozygosity⁵³. The parental lines used in the present study were not inbred to this level of homozygosity and parent heterozygosity may have contributed to the non-orthodox F₁ and F₂ inheritance patterns. Whilst the F₁ family EIO.MW17.Y1 were descendants from parents displaying the largest F_C3 divergence (Table 1), they also exhibited the highest level of F_C3 homogeneity (Table 2), and displayed a uniform monopartite distribution largely consistent with a single category (Figs 2a, 3a). Taken together these factors suggest parental homozygosity at alkyl cannabinoid-determining loci. Given that within-plant C₃/C₅ alkyl cannabinoid composition has been found to be stable over key developmental stages, environmental and ontogenetic effects are also likely to have contributed minimally to inheritance patterns observed in the filial generations.

Secondary metabolite gene clusters comprising of two or more non-homologous biosynthetic pathway genes have been identified across a number of diverse plant taxa⁵⁴. A common feature of these clusters is that they contain ‘signature genes’ in addition to other downstream pathway genes^54–56. Signature genes are often recruited from primary metabolism and encode the first committed biosynthetic steps of the pathway⁵⁷. For alkyl cannabinoid biosynthesis this is predicted to be the formation of alkylresorcinol fatty acid (FA) starter units^35,46,47, which, when incorporated into the resorcinyl skeletal core⁵⁸, influence directly carbon number of the resulting cannabinoid alkyl side-chain³⁷. While the arrangement of cannabinoid synthesis pathway genes appear to be randomly dispersed over five chromosomes³⁹, the enzymatic basis for cannabinoid FA starter unit synthesis, as well as genomic positioning of associated loci has yet to be established^39,46,47,59. Given that cannabinoid synthase loci have been localised to retrotransposon-rich genomic regions compatible with gene cluster formation^39,40, it is conceivable that upstream alkyl cannabinoid-determining loci may be physically clustered and/or co-inherited with THCAS and CBDAS genomic intervals.

The contrasting segregation ratios identified in CBDAS (B_CBDASB_CBDAS) and THCAS (B_THCASB_THCAS) homozygote F₂ progeny suggests the possibility of linkage between alkyl and cyclic chemotype-determining loci and may explain the distortion of alkyl cannabinoid ratios from a strictly additive polygenic model (Fig. 4a–d, Table 3). Rearrangement of THCAS and CBDAS genomic regions is evident in the experimental population from the incomplete dominance and irregularity of the intermediate chemotypic distribution (Fig. 3b). Incomplete linkage between the SCAR markers and tandem cannabinoid synthase arrays may have precipitated synthetic genotype-specific inheritance patterns, although uncoupling of the marker with functionally relevant loci is questionable given that genotypes were largely congruent with chemotypic distributions (Fig. 4a). The association of the SCAR marker assay with chemotype has also been established across a range of geographically and genetically divergent Cannabis germplasm^60,61.

In vitro feeding studies indicate that THCAS and CBDAS exhibit different catalytic efficiencies towards alkyl homologs⁶². This could be contributing to genotype-specific segregation patterns, although absence of appreciable levels of CBGA at UV 272 nm in filial F_C3 maxima chemotypes would suggest otherwise (Supplementary Fig. S2). The UV profiles of F_C5 plants were also dominated by CBDA and/or THCA and no comparable chromatographic peaks with a UV maxima and retention time consistent with CBGVA were observed. Whilst this would infer that cannabinoid synthases are capable of efficiently catalysing CBGA and CBGVA, it is conceivable that the affinity of alkyl homologs to THCAS and CBDAS is influencing the metabolic flux of oxidative cyclisation end-products, and hence the non-Mendelian inheritance patterns observed in filial chemotypes.

In the CBDAS homozygote (B_CBDASB_CBDAS) F₂ genotypes, the 9:3:3:1 ratio could be represented by A_C5¹ and A_C5² dominant and A_c3¹ and A_c3² recessive alleles, with double recessive genotypes A_c3¹A_c3¹A_c3²A_c3² resulting in F_C3 maxima chemotypes. Aliphatic glucosinolate side-chain length in Brassica oleracea is also regulated in a similar manner by independent assortment of GSL-PRO and GSL-ELONG⁶³. The 7:6:3 ratio identified in THCAS homozygote F₂ genotypes describes a more complex model, with dominance at one gene pair, and partial dominance at a second gene pair⁶⁴. When homozygous recessive (A_c5¹ A_c5¹), the first gene pair is epistatic to the second gene pair⁶⁴. Interestingly, a tripartite F_C3/F_C5 alkyl cannabinoid distribution was also identified from cluster analysis of a diversity panel comprised of predominantly tricyclic cannabinoid chemotypes¹⁵.

One speculative scenario to describe the aforementioned epistatic model is that THCAS co-inherited alkyl cannabinoid loci encode sequential interdependent enzymatic steps^65,66 (Fig. 5). De novo short-chain FA synthesis in planta is dependent on a series of enzymatic reactions involving β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydrase as well as enoyl-ACP reductase⁶⁷, followed by thioesterase hydrolysis to terminate synthesis⁶⁸. The dominant A_C3¹ allele at the first gene pair may govern one of four condensing, reductase or dehydrase reactions which contribute towards FA chain length⁶⁹, resulting in increased production of butanoyl-ACP (Fig. 5). A_C3² at the second gene pair could encode a thioesterase with high catalytic efficiency (kcat) towards butanoyl-ACP, thereby allowing FA plastid exportation of butanoic acid for downstream cytosolic-localised alkylresorcinol synthesis^47,68 (Fig. 5). The A_C3² modifier would act only on butanoyl-ACP and when homozygous recessive for A_c5¹, FA synthesis would be exclusive to the C₅ alkyl cannabinoid precursor hexanoic acid (Fig. 5).

Speculative digenic epistatic model governing alkyl cannabinoid composition in THCAS homozygote plants. The dominant AC31 allele at the first gene pair governs one of four condensing, reductase or dehydrase reactions forming butanoyl-ACP. The partially dominant allele AC32 at the second gene pair encodes an acyl-ACP thioesterase with high catalytic efficiency (kcat) for butanoyl-ACP. The acyl-ACP thioesterase allows plastid exportation of butanoic acid for cytosolic-localised alky cannabinoid biosynthesis. The homozygous recessive genotype (Ac51 Ac51) at the first gene pair results in the exclusive production of hexanoic acid and is epistatic to the second gene pair encoding the 4:0-ACP thioesterase; acyl activating enzyme (AAE); acyl-acyl carrier protein (ACP); cannabidiolic acid synthase (CBDAS); cannabidivarinic acid (CBDVA); cannabigerovarinic acid (CBGVA); divarinolic acid (DA); fatty acid (FA); geranyl pyrophosphate (GPP); olivetolic acid cyclase (OAC); prenyltransferase (PT); delta(9)-tetrahydrocannabinolic acid synthase (THCAS); delta(9)-tetrahydrocannabivarinic acid (THCVA); tetraketide synthase (TKS); C5 alkyl cannabinoid fraction (FC5); C3 alkyl cannabinoid fraction (FC3). — Figure 5Speculative digenic epistatic model governing alkyl cannabinoid composition in *THCAS* homozygote plants. The dominant A_C3¹ allele at the first gene pair governs one of four condensing, reductase or dehydrase reactions forming butanoyl-ACP. The partially dominant allele A_C3² at the second gene pair encodes an acyl-ACP thioesterase with high catalytic efficiency (kcat) for butanoyl-ACP. The acyl-ACP thioesterase allows plastid exportation of butanoic acid for cytosolic-localised alky cannabinoid biosynthesis. The homozygous recessive genotype (A_c5¹ A_c5¹) at the first gene pair results in the exclusive production of hexanoic acid and is epistatic to the second gene pair encoding the 4:0-ACP thioesterase; acyl activating enzyme (AAE); acyl-acyl carrier protein (ACP); cannabidiolic acid synthase (CBDAS); cannabidivarinic acid (CBDVA); cannabigerovarinic acid (CBGVA); divarinolic acid (DA); fatty acid (FA); geranyl pyrophosphate (GPP); olivetolic acid cyclase (OAC); prenyltransferase (PT); delta(9)-tetrahydrocannabinolic acid synthase (THCAS); delta(9)-tetrahydrocannabivarinic acid (THCVA); tetraketide synthase (TKS); C₅ alkyl cannabinoid fraction (F_C5); C₃ alkyl cannabinoid fraction (F_C3).

Previous analysis of six S₁ to S₆ inbred lines segregating for tricyclic C₃ and C₅ alkyl cannabinoids revealed a variety of lineage-specific distribution patterns³¹. A polygenic inheritance model was inferred from the absence of 100% ‘pure’ C₃-alkly cannabinoid chemotypes as well as from the mutual crossing of lineages increasing C₃ alkyl cannabinoid proportion from 85.5–95.6%³¹. In the present study, digenic inheritance patterns were adequate to explain F_C3 values ranging from 0.7–88.0% (Table 1, Fig. 4a).

Absence of F_C3 transgressive segregation or plants displaying F_C3 values > 90% suggests a chemotypic plateau has been reached in the experimental population (Table 1), and that parental genes lack a complementary additive effect on F_C3 values⁷⁰. A number of enzymatic reactions occur prior to oxidative cyclisation by THCAS and CBDAS. These involve a series of steps leading to FA formation in addition to acyl activation⁴⁷, two-step polyketide synthesis³⁸ and aromatic prenylation³³ (Fig. 5), of which a minimum of two catalytic steps were found to be allelic and determinant of chemotype (Table 3, Fig. 4b,d). Analysis of cannabinoid biosynthesis in engineered yeast indicates that acyl activation, polyketide synthesis and aromatic prenylation steps are catalysed by promiscuous enzymes, with recombinant pathway proteins capable of producing a variety of alkyl homologs based on the type of FA starter unit fed³⁷. Assuming cannabinoid pathway loci are allelic and encode enzymes with varying levels of promiscuity³⁷, gene-flow at these loci may confer an additive or epistatic effect and a polygenic alkyl cannabinoid inheritance model may be correct. However, with consideration of measurement error and environmental deviation^15,71, the lineage-specific gene effects reported from mutual crossing may only be marginal.

Regardless of the total number of loci contributing to alkyl-cannabinoid composition, inheritance patterns reported here and elsewhere suggest the partitioning of allelic variation among lineages³¹. Inter-lineage genetic heterogeneity has the potential to confound elucidation of the genetic architecture underlying alkyl cannabinoid composition when using forward genetic approaches. Quantitative Trait Locus (QTL) mapping may only capture a subset of inter-lineage allelic diversity and associated epistasis in natural populations⁷², while in Genome Wide Association Studies (GWAS), genetic heterogeneity among lineages reduces the power to detect causal variants^73,74. In these cases, synthetic and/or ancestral marker loci may be more predictive of phenotype when two or more gene mutations have a comparable phenotypic effect⁷⁴. Given that lineage-specific evolutionary processes are implicated at cannabinoid pathway loci⁴⁰, comparative genomic approaches using representative germplasm may precipitate diagnostically valuable chemotype-associated markers while also potentially delineating candidate alkyl cannabinoid loci for genome engineering⁸.

The analysis of filial chemotypes was targeted towards variation in alkyl side-chain length. Whilst this analysis improved understanding of the heritability of cannabinoid homology, much remains to be examined. In addition to variation in the topological arrangement of the isoprenoid residue¹³, prenylogous versions of cannabinoids have been identified in the form of sesquicannabigerol⁷⁵. This degree of isoprenylation improved pharmacological potency towards CB₂R and it is possible that other medically relevant cannabinoid prenylogues may exist⁷⁵. Further non-targeted cannabinomic analyses, combined with forward genetic screens, may further elucidate the molecular basis for cannabinoid homology and ultimately expand the number of therapeutics which can be produced in planta.

In conclusion, the inheritance of alkyl cannabinoid composition and associated allelic assortment with THCAS and CBDAS was examined. Digenic segregation patterns observed in cannabinoid synthase genotypes suggests a complex mode of inheritance for alkyl side-chain length involving epistasis, linkage as well as dominant and lineage-specific gene effects. Linking plant secondary metabolites to underlying biosynthetic genes and associated regulatory networks remains challenging and often requires a multifaceted approach^76,77. Comparative genomic approaches may contribute to understanding of the molecular basis for alkyl cannabinoid composition and shed light on the recruitment and evolution of pathway genes. Advances in understanding of the inheritance and biosynthesis of the alkyl pharmacophore may also allow for metabolic engineering of Cannabis to accelerate development of novel efficacious plant-derived cannabinoid homologs with augmented therapeutic activities.

Methods

Genetic resources and cultivation

Acquisition and storage of research materials and associated experimental procedures were conducted under the provisions of the Drug Misuse and Trafficking Act 1985 and in accordance with authorisations granted to Professor Graham King by the New South Wales Ministry of Health, Pharmaceutical Regulatory Unit, Legal and Regulatory Services Branch, Australia. Three Cannabis sativa L. seed pack accessions EIO.MW15.P, EIO.MW15.T and EIO.MW17.X associated with either high C₃ alkyl (F_C3) tricyclic (F_tricyclic) or high C₅ alkyl (F_C5) dicyclic (F_dicyclic) compositions were sourced from the Ecofibre Industries Operations Pty Ltd Global Germplasm Collection (EFGGC) (Table 1).

Twenty seeds per accession were sown into 400 mL round pots at a depth of 1.5 cm. Each pot contained a growing medium containing one-part vermiculite, one-part perlite and one-part peat moss, as well as dolomite (110 g/100 L). Pots were watered daily and supplemented with CANNA^® Aqua Vega nutrient solution post germination upon full extension of the first leaflet pair. Seedlings were grown indoors within bespoke pollen secure growth chambers and grown under an 11 h photoperiod using high pressure sodium (HPS) and metal halide (MH) lighting (luminous flux = 72,000 lumens). At the flower primordia stage (code 2001)⁷⁸, selected plants were transferred into single 8 L pots containing 100 g Osmocote^® Exact slow release nutrient mix and 8 g of Micromax^® micronutrient formula. Optimal water regimes were controlled using automatic ‘smart valves’ and temperature was maintained between 26 and 28 °C.

Experimental populations

Individual plants from accessions EIO.MW15.P (n = 22), EIO.MW15.T (n = 18), EIO.MW17.X (n = 13) were screened for chemotype using LC-MS cannabinoid profiling at the vegetative stage (code 1008)⁷⁸ (Table 1). Plants which exhibited high F_C3 and F_tricyclic (e.g. THCVA) or high F_C5 and F_dicyclic (e.g. CBDA) cannabinoid values were selected for crossing (Table 1, Fig. 1). Sex was provisionally phenotyped from visual inspection during the flower primordia developmental stage prior to male anthesis (code 2001)⁷⁸. Plant vigour was also considered during selection. Eight chemotypically extreme male and female plants high in THCVA (EIO.MW15.P) or CBDA (EIO.MW15.T and EIO.MW17.X) served as parents for four F₁ hybrid families, which were generated from two biparental reciprocal crosses (Table 1, Fig. 1). Generation of 210 F₂ progeny was achieved by crossing a single male and female plant from the F₁ hybrid family which exhibited the highest level of F_C3 chemotypic homogeneity. Biparental crosses were performed within pollen secure growth chambers. Pollination of female plants was achieved through exposure to male plants during anthesis.

LC-MS chemotyping

Liquid chromatography-mass spectrometry (LC-MS) cannabinoid profiling and extraction of individual plants followed methodologies described by Welling et al.¹⁵. At the vegetative stage (fourth leaf pair, code 1008)⁷⁸, two × 250 mg fresh leaf material was taken from the sub-apical raceme at opposing phyllotaxis. Plant material was transferred to a 2 mL Eppendorf^® Safe-Lock microcentrifuge tubes containing a 3 mm Qiagen Tungsten Carbide Bead and frozen using liquid nitrogen. Plant tissue was disrupted using a Qiagen TissueLyser^® by agitation at 30 rotations per sec for 60 s. Plant tissue was vortexed in 1 mL of high-performance liquid chromatography (HPLC) grade EtOH and mixed by agitation for 30 min. Extracts were centrifuged to remove particulate matter and 600 μL of the supernatant was transferred into a 2 mL screw cap glass vial.

LC-MS runs were performed using an Agilent 1290 Infinity analytical HPLC instrument (Agilent Technologies, Palo Alto, CA, United States), which comprised of a vacuum degasser, autoinjector, binary pump and diode array detector (DAD, 1260), coupled to an Agilent 6120 Single Quadrupole Mass Selective Detector (MSD). Analytical infrastructure was controlled using ChemStation (Agilent) software (Rev. B.04.03 [54]). A C₁₈ Agilent Eclipse plus rapid resolution high definition column (1.8 μm; 50 mm × 2.1 mm internal diameter) was used. Absorbance was monitored at 210, 214, 272, 280, 330 and 360 nm.

The mobile phase consisted of a mixture of Milli-Q^® water (channel A) and acetonitrile (channel B) containing 0.005% trifluoroacetic acid (TFA). The initial setting was isocratic at 66% B for 8 min, which was linearly increased to 95% B over 4 min. 95% B was maintained for 1 min and then re-equilibrated to 66% B for 2 min. Total run time including an internal needle wash was 16 min. Flow rate was 0.3 mL/min. Column temperature was set to 30 °C. Injection volume was 3 μL. The MSD was run in atmospheric pressure electrospray ionisation mode (AP-ESI). Selected-ion monitoring (SIM) was used for cannabinoid quantification, with abundant and representative signals obtained in positive mode [M + H]⁺ ¹⁵; drying gas temperature, 350 °C; capillary voltage, 3000 V (positive); vaporiser temperature, 350 °C; drying gas flow, 12 L/min (N2); nebuliser pressure, 35 psi; scan mass range, 100–1200; fragmentor, 150.

Cannabinoid standards cannabinol (CBN), CBGA, cannabigerol (CBG), cannabidiolic acid (CBDA), CBD, cannabidivarin (CBDV), cannabichromene (CBC), delta(9)-tetrahydrocannabinolic acid (THCA), THC, and delta(9)-tetrahydrocannabivarin (THCV) were sourced from Novachem Pty Ltd. (Melbourne, VIC, Australia). THCVA and CBDVA were developed in-house using an Agilent 1260 Infinity preparative HPLC system, with purified fractions structurally elucidated using a Bruker Avance III HDX 800 MHz spectrometer¹⁵. Calibration solutions for acidic as well as neutral reference cannabinoids were prepared at 100, 20, 4, 0.8, 0.16, 0.032 μg/mL and calibration curves for each cannabinoid were linear across the calibration range (r² > 0.99). Precision was determined by injecting stock solutions six times and monitoring cannabinoid peak area (relative standard deviation (RSD) < 2%). Interday MSD variability was minimised by running calibration curves every 48 hours. Data acquisition and analysis was performed using Agilent ChemStation^© (Rev. B.04.03 [54]) software.

Locus B DNA SCAR marker

Plant DNA was extracted using a Qiagen DNeasy^® Plant Mini Kit, with tissue disruption achieved using a Qiagen TissueLyser^®. DNA purity was assessed using a ThermoScientific^TM NanoDrop^TM 2000 UV–vis spectrophotometer. An absorbance ratio of ~1.8 at 260/280 nm and symmetric peaks at 260 nm were used to determine DNA quality.

Amplification of CBDAS (B1080) and THCAS (B1190) sequence characterised amplified region (SCAR) fragments was accomplished using a B locus-specific multiplex PCR assay comprising of three primers: a primer common to CBDAS and THCAS FW: 5′ AAGAAAGTTGGCTTGCAG 3′ as well as a CBDAS-specific REV: 5′ ATCCAGTTTAGATGCTTTTCGT 3′ and a THCAS-specific REV: 5′ TTAGGACTCGCATGATTAGTTTTTC 3′ primer^60,79.

PCR parameters followed those described by Welling et al.⁶¹. Reactions were performed in 0.2 mL 96 well PCR plates in a total volume of 50 µL and contained 1.5 mM of MgCl₂, 0.2 mM of dNTPs, 0.4 µM of the forward primer, 0.2 µM of the THCAS- as well as the CBDAS-specific reverse primers, and 2 U of Life Technologies Platinum^® Taq DNA Polymerase. Thermocycling parameters for the DNA template were as follows: 94 °C for 2 min, followed by 25 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min 15 s. No final extension was required. CBDAS- and THCAS-specific fragments were then separated using electrophoresis with a 1% SeaKem^® LE agarose gel stained with GelRed^TM. Amplicons were visualised under UV illumination with a Bio-Rad Molecular Imager^® Gel Doc^TM XR + system using Image Lab^TM software.

Statistical analysis

CBDVA, THCVA, CBDA, THCA, CBDV, THCV, CBD and THC fresh weight (w/w) content was determined per plant. Relative proportions of these cannabinoids was used to generate C₃ alkyl (F_C3), C₅ alkyl (F_C5), dicyclic (F_dicyclic) and tricyclic (F_tricyclic) cannabinoid fractions within the total cannabinoid fraction. To minimise post-harvest alteration of cannabinoid composition, decarboxylated cannabinoids CBDV, THCV, CBD and THC were expressed as carboxylated acid (COOH) cannabinoids using formulae which compensate for changes in molecular weight¹⁵. Repeatability between LC-MS replicate extractions were calculated using coefficient of determination (r²). Strong correlations between duplicate extraction replicates were found for the F_C3/F_C5 (r² > 0.99) as well as for the F_dicyclic/F_tricyclic (r² > 0.99) values. Mean extraction replicate values were therefore used for statistical analysis.

Alkyl cannabinoid data from the F₂ generation was visualised in a graphical format used previously³¹ (Supplementary Fig. S3). Analysis of F₂ chemotypic distribution patterns revealed stepwise increases in F_C3 values, although accurate demarcation of data points was not possible (Supplementary Fig. S3). Histograms were then developed to establish frequency distributions for categorisation (Supplementary Fig. S3). However, the continuity of chemotype prevent formation of obvious break points in the data (Supplementary Fig. S3). The arbitrary selection of bins was also deemed inappropriate for determining distributions due to the potential for incorrect assignment of genotype (classification error). To address these issues, kernel density was used to estimate the unknown underlying distributions within the data. This constructed an estimate of the density function from observations within the data⁴³, generating a fitted solid line over the F_C3 value data points (Supplementary Fig. S3). The area under kernel density estimates (KDE) was then used to demarcate F_C3 values and to objectively categorise plants (Supplementary Fig. S3), circumventing arbitrary categorisation and the artificial grouping of F_C3 values.

GenStat 64-bit Release 18.1 (VSN International Ltd.) software was used to calculate Bartlett’s test for homogeneity of variances, KDE and Pearson’s chi-squared (χ²) goodness-of-fit. For KDE, automatic estimation of the bandwidth h was achieved using the method proposed by Sheather and Jones⁸⁰. Kernels supported by a frequency of n = 1 were not considered. Categorisation frequencies for Pearson’s χ² goodness-of-fit were obtained by baseline peak integration of KDE, which provided chemotypic grid point inclusion/exclusion boundaries (Supplementary Fig. S3).

Supplementary information

Untitled section

Acknowledgements

The authors wish to acknowledge Ecofibre Pty Ltd. for allowing Southern Cross University access to the Ecofibre Global Germplasm Collection and for providing valuable information relevant to the selection of accessions. The authors would also like to acknowledge the material and financial support provided by Ecofibre.

Author Contributions

M.W. prepared the manuscript, designed and performed experiments, including the development of experimental populations as well as chemical and genetic analysis. L.L. contributed to the development of analytical procedures and performed detailed review and revision of the manuscript. C.R. performed statistical analyses as well as review and revision of the manuscript. T.K. contributed to the analysis of chemotypes as well as review and revision of the manuscript. O.A. provided background information and performed review and revision of the manuscript. G.K. provided substantial contributions to conception and design of the research project and performed detailed review and revision of the manuscript.

Data Availability

The LC-MS datasets derived from experimental populations generated and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing Interests

Southern Cross University receives funding from the commercial entity Ecofibre Pty Ltd. Ananda Hemp Ltd are a subsidiary company of Ecofibre. Matthew Welling received a stipend from Ecofibre. Omid Ansari is an employee of Ecofibre. Lei Liu, Carolyn A. Raymond, Tobias Kretzschmar and Graham J. King declare no potential conflict of interest.

Footnotes

Footnote Group

Supplementary information

Supplementary information accompanies this paper at 10.1038/s41598-019-47812-2.

References

Untitled section

References

1.Zhang Q, et al. Latitudinal adaptation and genetic insights into the origins of Cannabis sativa L. Front. Plant Sci. 2018;9:1876. doi: 10.3389/fpls.2018.01876.
2.Soler S, et al. Genetic structure of Cannabis sativa var. indica cultivars based on genomic SSR (gSSR) markers: implications for breeding and germplasm management. Ind. Crops Prod. 2017;104:171–178. doi: 10.1016/j.indcrop.2017.04.043.
3.Small E, Cronquist A. A practical and natural taxonomy for Cannabis. Taxon. 1976;25:405–435. doi: 10.2307/1220524.
4.Mandolino G, Carboni A. Potential of marker-assisted selection in hemp genetic improvement. Euphytica. 2004;140:107–120. doi: 10.1007/s10681-004-4759-6.
5.Chandra S, Lata H, ElSohly MA, Walker LA, Potter D. Cannabis cultivation: methodological issues for obtaining medical-grade product. Epilepsy Behav. 2017;70:302–312. doi: 10.1016/j.yebeh.2016.11.029.
6.Small E, Naraine SG. Size matters: evolution of large drug-secreting resin glands in elite pharmaceutical strains of Cannabis sativa (marijuana) Genet. Resour. Crop Evol. 2015;63:349–359. doi: 10.1007/s10722-015-0254-2.
7.Zhou X, et al. Early agricultural development and environmental effects in the Neolithic Longdong basin (eastern Gansu) Chin. Sci. Bull. 2011;56:762. doi: 10.1007/s11434-010-4286-x.
8.Welling MT, et al. A belated green revolution for Cannabis: virtual genetic resources to fast-track cultivar development. Front. Plant Sci. 2016;7:1113. doi: 10.3389/fpls.2016.01113.
9.Hanuš LO, et al. Enantiomeric cannabidiol derivatives: synthesis and binding to cannabinoid receptors. Org. Biomol. Chem. 2005;3:1116–1123. doi: 10.1039/B416943C.
10.Gertsch J, Pertwee RG, Di Marzo V. Phytocannabinoids beyond the Cannabis plant–do they exist? Br. J. Pharmacol. 2010;160:523–529. doi: 10.1111/j.1476-5381.2010.00745.x.
11.Happyana N, et al. Analysis of cannabinoids in laser-microdissected trichomes of medicinal Cannabis sativa using LCMS and cryogenic NMR. Phytochemistry. 2013;87:51–59. doi: 10.1016/j.phytochem.2012.11.001.
12.Dussy FE, Hamberg C, Luginbühl M, Schwerzmann T, Briellmann TA. Isolation of Δ9-THCA-A from hemp and analytical aspects concerning the determination of Δ9-THC in Cannabis products. Forensic Sci. Int. 2005;149:3–10. doi: 10.1016/j.forsciint.2004.05.015.
13.Hanuš LO, Meyer SM, Muñoz E, Taglialatela-Scafati O, Appendino G. Phytocannabinoids: a unified critical inventory. Nat. Prod. Rep. 2016;33:1357–1392. doi: 10.1039/c6np00074f.
14.Hazekamp A, Tejkalová K, Papadimitriou S. Cannabis: from cultivar to chemovar II-a metabolomics approach to Cannabis classification. Cannabis Cannabinoid Res. 2016;1:202–215. doi: 10.1089/can.2016.0017.
15.Welling MT, Liu L, Raymond CA, Ansari O, King GJ. Developmental plasticity of the major alkyl cannabinoid chemotypes in a diverse Cannabis genetic resource collection. Front. Plant Sci. 2018;9:1510. doi: 10.3389/fpls.2018.01510.
16.Hillig KW, Mahlberg PG. A chemotaxonomic analysis of cannabinoid variation in Cannabis (Cannabaceae) Am. J. Bot. 2004;91:966–975. doi: 10.3732/ajb.91.6.966.
17.Vree T, Breimer D, Ginneken C, Rossum J. Identification in hashish of tetrahydrocannabinol, cannabidiol and cannabinol analogues with a methyl side‐chain. J. Pharm. Pharmacol. 1972;24:7–12. doi: 10.1111/j.2042-7158.1972.tb08857.x.
18.Smith R. Identification of butyl cannabinoids in marijuana. J. Forensic Sci. 1997;42:610–618. doi: 10.1520/JFS14173J.
19.Di Marzo V. New approaches and challenges to targeting the endocannabinoid system. Nat. Rev. Drug Discov. 2018;17:623–639. doi: 10.1038/nrd.2018.115.
20.Toczek M, Malinowska B. Enhanced endocannabinoid tone as a potential target of pharmacotherapy. Life Sci. 2018;204:20–45. doi: 10.1016/j.lfs.2018.04.054.
21.Muntoni AL, et al. Cannabinoids modulate spontaneous neuronal activity and evoked inhibition of locus coeruleus noradrenergic neurons. Eur. J. Neurosci. 2006;23:2385–2394. doi: 10.1111/j.1460-9568.2006.04759.x.
22.Moranta D, Esteban S, García-Sevilla JA. Differential effects of acute cannabinoid drug treatment, mediated by CB 1 receptors, on the in vivo activity of tyrosine and tryptophan hydroxylase in the rat brain. Naunyn Schmiedebergs Arch. Pharmacol. 2004;369:516–524. doi: 10.1007/s00210-004-0921-x.
23.Cencioni MT, et al. Anandamide suppresses proliferation and cytokine release from primary human T-lymphocytes mainly via CB2 receptors. PloS One. 2010;5:e8688. doi: 10.1371/journal.pone.0008688.
24.Murai M, et al. SA13353 (1-[2-(1-adamantyl) ethyl]-1-pentyl-3-[3-(4-pyridyl) propyl] urea) inhibits TNF-α production through the activation of capsaicin-sensitive afferent neurons mediated via transient receptor potential vanilloid 1 in vivo. Eur. J. Pharmacol. 2008;588:309–315. doi: 10.1016/j.ejphar.2008.04.037.
25.Thiele EA, et al. Cannabidiol in patients with seizures associated with Lennox-Gastaut syndrome (GWPCARE4): a randomised, double-blind, placebo-controlled phase 3 trial. Lancet. 2018;391:1085–1096. doi: 10.1016/S0140-6736(18)30136-3.
26.Lichtman AH, et al. Results of a double-blind, randomized, placebo-controlled study of nabiximols oromucosal spray as an adjunctive therapy in advanced cancer patients with chronic uncontrolled pain. J. Pain Symptom Manage. 2018;55:179–188. e171. doi: 10.1016/j.jpainsymman.2017.09.001.
27.Prandi C, Blangetti M, Namdar D, Koltai H. Structure-activity relationship of cannabis derived compounds for the treatment of neuronal activity-related diseases. Molecules. 2018;23:1526. doi: 10.3390/molecules23071526.
28.Thakur GA, Duclos RI, Makriyannis A. Natural cannabinoids: templates for drug discovery. Life Sci. 2005;78:454–466. doi: 10.1016/j.lfs.2005.09.014.
29.Razdan RK. Structure-activity relationships in cannabinoids. Pharmacol. Rev. 1986;38:75–149.
30.Martin B, et al. Manipulation of the tetrahydrocannabinol side chain delineates agonists, partial agonists, and antagonists. J. Pharmacol. Exp. Ther. 1999;290:1065–1079.
31.De Meijer EPM, Hammond KM. The inheritance of chemical phenotype in Cannabis sativa L. (V): regulation of the propyl-/pentyl cannabinoid ratio, completion of a genetic model. Euphytica. 2016;210:291–307. doi: 10.1007/s10681-016-1721-3.
32.Fellermeier M, Eisenreich W, Bacher A, Zenk MH. Biosynthesis of cannabinoids: incorporation experiments with 13C‐labeled glucoses. Eur. J. Biochem. 2001;268:1596–1604. doi: 10.1046/j.1432-1327.2001.02030.x.
33.Page, J. E. & Boubakir, Z. Aromatic prenyltransferase from Cannabis. (2011).
34.Cook D, et al. Alkylresorcinol synthases expressed in Sorghum bicolor root hairs play an essential role in the biosynthesis of the allelopathic benzoquinone sorgoleone. Plant Cell. 2010;22:867–887. doi: 10.1105/tpc.109.072397.
35.Flores-Sanchez IJ, Verpoorte R. Secondary metabolism in cannabis. Phytochem. Rev. 2008;7:615–639. doi: 10.1007/s11101-008-9094-4.
36.Valliere MA, et al. A cell-free platform for the prenylation of natural products and application to cannabinoid production. Nat. Commun. 2019;10:565. doi: 10.1038/s41467-019-08448-y.
37.Luo X, et al. Complete biosynthesis of cannabinoids and their unnatural analogues in yeast. Nature. 2019;567:123–126. doi: 10.1038/s41586-019-0978-9.
38.Gagne SJ, et al. Identification of olivetolic acid cyclase from Cannabis sativa reveals a unique catalytic route to plant polyketides. Proc. Natl. Acad. Sci. USA. 2012;109:12811–12816. doi: 10.1073/pnas.1200330109.
39.Laverty KU, et al. A physical and genetic map of Cannabis sativa identifies extensive rearrangements at the THC/CBD acid synthase loci. Genome Res. 2019;29:146–156. doi: 10.1101/gr.242594.118.
40.Grassa, C. J. et al. A complete Cannabis chromosome assembly and adaptive admixture for elevated cannabidiol (CBD) content. BioRxiv, 10.1101/458083 (2018).
41.De Meijer EPM, et al. The inheritance of chemical phenotype in Cannabis sativa L. Genetics. 2003;163:335–346. doi: 10.1007/s10681-005-1164-8.
42.Weiblen GD, et al. Gene duplication and divergence affecting drug content in Cannabis sativa. New Phytol. 2015;208:1241–1250. doi: 10.1111/nph.13562.
43.Silverman, B. W. Density estimation for statistics and data analysis. (Routledge, 2018).
44.Zhang T, Jia X, Xu Z. The limitations of polygenic hypothesis and theorizing about dual multiple factors and three normal distributions. Appl. Math. 2016;7:912–919. doi: 10.4236/am.2016.79081.
45.Griffiths, A., Gelbart, W., Miller, J. & Lewontin, R. Modern genetic analysis. (WH Freeman, 1999).
46.Marks MD, et al. Identification of candidate genes affecting Δ9-tetrahydrocannabinol biosynthesis in Cannabis sativa. J. Exp. Bot. 2009;60:3715–3261. doi: 10.1093/jxb/erp210.
47.Stout JM, Boubakir Z, Ambrose SJ, Purves RW, Page JE. The hexanoyl-CoA precursor for cannabinoid biosynthesis is formed by an acyl-activating enzyme in Cannabis sativa trichomes. Plant J. 2012;71:353–365. doi: 10.1111/j.1365-313X.2012.04949.x.
48.Ruiz‐Sola MÁ, et al. Arabidopsis geranylgeranyl diphosphate synthase 11 is a hub isozyme required for the production of most photosynthesis‐related isoprenoids. New Phytol. 2016;209:252–264. doi: 10.1111/nph.13580.
49.Erickson E, Wilcox J, Cavins J. Inheritance of altered palmitic acid percentage in two soybean mutants. J. Hered. 1988;79:465–468. doi: 10.1093/oxfordjournals.jhered.a110552.
50.Chen ZJ. Genomic and epigenetic insights into the molecular bases of heterosis. Nat. Rev. Genet. 2013;14:471. doi: 10.1038/nrg3503.
51.Cubillos AER, et al. Inheritance patterns in metabolism and growth in diallel crosses of Arabidopsis thaliana from a single growth habitat. Heredity. 2018;120:463. doi: 10.1038/s41437-017-0030-5.
52.Oakey H, Verbyla A, Pitchford W, Cullis B, Kuchel H. Joint modeling of additive and non-additive genetic line effects in single field trials. Theor Appl GenetTheoretical and Applied Genetics. 2006;113:809–819. doi: 10.1007/s00122-006-0333-z.
53.Seymour DK, et al. Rapid creation of Arabidopsis doubled haploid lines for quantitative trait locus mapping. Proc. Natl. Acad. Sci. USA. 2012;109:4227–4232. doi: 10.1073/pnas.1117277109.
54.Boycheva S, Daviet L, Wolfender J-L, Fitzpatrick TB. The rise of operon-like gene clusters in plants. Trends Plant Sci. 2014;19:447–459. doi: 10.1016/j.tplants.2014.01.013.
55.Nützmann HW, Huang A, Osbourn A. Plant metabolic clusters–from genetics to genomics. New Phytol. 2016;211:771–789. doi: 10.1111/nph.13981.
56.Osbourn A. Secondary metabolic gene clusters: evolutionary toolkits for chemical innovation. Trends Genet. 2010;26:449–457. doi: 10.1016/j.tig.2010.07.001.
57.Hamberger B, Bak S. Plant P450s as versatile drivers for evolution of species-specific chemical diversity. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 2013;368:20120426. doi: 10.1098/rstb.2012.0426.
58.Suzuki Y, Kurano M, Esumi Y, Yamaguchi I, Doi Y. Biosynthesis of 5-alkylresorcinol in rice: incorporation of a putative fatty acid unit in the 5-alkylresorcinol carbon chain. Bioorg. Chem. 2003;31:437–452. doi: 10.1016/j.bioorg.2003.08.003.
59.Van Bakel H, et al. The draft genome and transcriptome of Cannabis sativa. Genome Biol. 2011;12:R102. doi: 10.1186/gb-2011-12-10-r102.
60.Onofri C, de Meijer EPM, Mandolino G. Sequence heterogeneity of cannabidiolic- and tetrahydrocannabinolic acid-synthase in Cannabis sativa L. and its relationship with chemical phenotype. Phytochemistry. 2015;116:57–68. doi: 10.1016/j.phytochem.2015.03.006.
61.Welling M, Liu L, Shapter T, Raymond C, King G. Characterisation of cannabinoid composition in a diverse Cannabis sativa L. germplasm collection. Euphytica. 2016;208:463–475. doi: 10.1007/s10681-015-1585-y.
62.Shoyama Y, Hirano H, Nishioka I. Biosynthesis of propyl cannabinoid acid and its biosynthetic relationship with pentyl and methyl cannabinoid acids. Phytochemistry. 1984;23:1909–1912. doi: 10.1016/S0031-9422(00)84939-0.
63.Li G, Riaz A, Goyal S, Abel S, Quiros C. Inheritance of three major genes involved in the synthesis of aliphatic glucosinolates in Brassica oleracea. J. Am. Soc. Hortic. Sci. 2001;126:427–431. doi: 10.21273/JASHS.126.4.427.
64.Miko, I. In Nature Education Vol. 1 197 (2008).
65.Nadeau JH. Modifier genes in mice and humans. Nat. Rev. Genet. 2001;2:165–174. doi: 10.1038/35056009.
66.Cheema J, Faraldos JA, O’Maille PE. Epistasis and dominance in the emergence of catalytic function as exemplified by the evolution of plant terpene synthases. Plant Sci. 2017;255:29–38. doi: 10.1016/j.plantsci.2016.11.006.
67.Marchive C, Nikovics K, To A, Lepiniec L, Baud S. Transcriptional regulation of fatty acid production in higher plants: molecular bases and biotechnological outcomes. Eur. J. Lipid Sci. Technol. 2014;116:1332–1343. doi: 10.1002/ejlt.201400027.
68.Salas JnJ, Ohlrogge JB. Characterization of substrate specificity of plant FatA and FatB acyl-ACP thioesterases. Arch. Biochem. Biophys. 2002;403:25–34. doi: 10.1016/S0003-9861(02)00017-6.
69.Leonard JM, Knapp SJ, Slabaugh MB. A Cuphea β‐ketoacyl‐ACP synthase shifts the synthesis of fatty acids towards shorter chains in Arabidopsis seeds expressing Cuphea FatB thioesterases. Plant J. 1998;13:621–628. doi: 10.1046/j.1365-313X.1998.00066.x.
70.Rick CM, Smith PG. Novel variation in tomato species hybrids. Am. Nat. 1953;87:359–373. doi: 10.1086/281796.
71.Geiler-Samerotte K, et al. The details in the distributions: why and how to study phenotypic variability. Curr. Opin. Biotechnol. 2013;24:752–759. doi: 10.1016/j.copbio.2013.03.010.
72.Symonds VV, et al. Mapping quantitative trait loci in multiple populations of Arabidopsis thaliana identifies natural allelic variation for trichome density. Genetics. 2005;169:1649–1658. doi: 10.1534/genetics.104.031948.
73.Manchia M, et al. The impact of phenotypic and genetic heterogeneity on results of genome wide association studies of complex diseases. PloS One. 2013;8:e76295. doi: 10.1371/journal.pone.0076295.
74.Korte A, Farlow A. The advantages and limitations of trait analysis with GWAS: a review. Plant Methods. 2013;9:29. doi: 10.1186/1746-4811-9-29.
75.Pollastro F, et al. Bioactive prenylogous cannabinoid from fiber hemp (Cannabis sativa) J Nat. Pro. 2011;74:2019–2022. doi: 10.1021/np200500p.
76.Jiang J, et al. VvWRKY8 represses stilbene synthase genes through direct interaction with VvMYB14 to control resveratrol biosynthesis in grapevine. J. Exp. Bot. 2018;70:715–729. doi: 10.1093/jxb/ery401.
77.Chen W, et al. Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism. Nat. Genet. 2014;46:714–721. doi: 10.1038/ng.3007.
78.Mediavilla V, Jonquera M, Schmid-Slembrouck I, Soldati A. Decimal code for growth stages of hemp (Cannabis sativa L.) J. Int. Hemp Assoc. 1998;5:68–74.
79.Pacifico D, et al. Genetics and marker-assisted selection of the chemotype in Cannabis sativa L. Mol. Breed. 2006;17:257–268. doi: 10.1007/s11032-005-5681-x.
80.Sheather SJ, Jones MC. A reliable data-based bandwidth selection method for kernel density estimation. J. R. Stat. Soc. Series B Stat. Methodol. 1991;53:683–690. doi: 10.1111/j.2517-6161.1991.tb01857.x.

Associated Data

Supplementary Materials

Data Availability Statement

The LC-MS datasets derived from experimental populations generated and/or analysed during the current study are available from the corresponding author on reasonable request.

Studies

Conditions

Cannabinoids and active compounds

Related research

Abstract

Untitled section

Article notes

Untitled section

Author notes

Introduction

Results

Parental selection

F1 hybrid chemotypic uniformity

Inheritance patterns of the F2 progeny

Locus B genotype-specific alkyl cannabinoid distributions

Discussion

Methods

Genetic resources and cultivation

Experimental populations

LC-MS chemotyping

Locus B DNA SCAR marker

Statistical analysis

Supplementary information

Untitled section

Acknowledgements

Author Contributions

Data Availability

Competing Interests

Footnotes

Footnote Group

Supplementary information

References

Untitled section

References

Associated Data

Supplementary Materials

Data Availability Statement

Additional materials

F₁ hybrid chemotypic uniformity

Inheritance patterns of the F₂ progeny